Transcript asmbl_31333

Sequence
Transcript Sequence for observation asmbl_31333 of TGE0001355:
GCGGGACTCTCGGGAGAAGCTCGGCGCATCATTGGGCGGTGGACCGCCCCTCGGCCCCGGGGTAGGCTGACACGGGAGGGTCCTCAGCTAAAGCCAAAAGCAGATCAAAGTGGTGGGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGGCGCTCGCCCTCGCTCTCCTCGCCCTCCGCCCCGGCCCCGGCCCCGCGCCCGCCATGGAGAAGACTGAGCTGATCCAGAAGGCCAAGCTGGCCGAGCAGGCCGAGCGCTACGACGACATGGCCACCTGCATGAAGGCAGTGACCGAGCAGGGCGCCGAGCTGTCCAACGAGGAGCGCAACCTGCTCTCCGTGGCCTACAAGAACGTGGTCGGGGGCCGCAGGTCCGCCTGGAGGGTCATCTCTAGCATCGAGCAGAAGACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAGGACTATCGGGAGAAAGTGGAGTCCGAGCTGAGATCCATCTGCACCACGGTGCTGGAATTGTTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAAATGAAGGGTGATTACTTCCGGTACCTTGCTGAAGTTGCGTGTGGTGATGATCGAAAACAAACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCATTTGATATAAGCAAGAAAGAGATGCAACCCACACACCCAATCCGCCTGGGGCTTGCTCTTAACTTTTCTGTATTTTACTATGAGATTCTTAATAACCCAGAGCTTGCCTGCACGCTGGCTAAAACGGCTTTTGATGAGGCCATTGCTGAACTTGATACACTGAATGAAGACTCATACAAAGACAGCACCCTCATCATGCAGTTGCTTAGAGACAACCTAACACTTTGGACATCAGACAGTGCAGGAGAAGAATGTGATGCGGCAGAAGGGGCTGAAAACTAAATCCATACAGGGTGTCATCCTTCTTTCCTTCAAGAAACCTTTTTACACATCTCCATTCCTTATTCCACTTGGATTTCCTATAGCAAAGAAACCCATTCATGTGTATGGAATCAACTGTTTATAGTCTTTTCACACTGCAGCTTTGGGAAAACTTCATTCCTTGATTTGTGTTTGTCTTGGCCTTCCTGGTGTGCAGTACTGCTGTAGAAAAGTATTAATAGCTTCATTTCATATAAACATAAGTAACTCCCAAACACTTATGTAGAGGACTAAAAATGTATCTGGTATTTAAGTAATCTGAACCAGTTCTGCAAGTGACTGTGTTTTGTATTACTGTGAAAATAAGAAAATGTAGTTAATTACAATTTAAAGAGTATTCCACATAACTTCTTAATTTCTACATTCCCTCCCTTACTCTTCGGGGGTTTCCTTTCAGTAAGCAACTTTTCCATGCTCTTAATGTATTCCTTTTTAGTAGGAATCCGGAAGTATTAGATTGAATGGAAAAGCACTTGCCATCTCTGTCTAGGGGTCACAAATTGAAATGGCTCCTGTATCACATACGGAGGTCTTGTGTATCTGTGGCAACAGGGAGTTTCCTTATTCACTCTTTATTTGCTGCTGTTTAAGTTGCCAACCTCCCCTCCCAATAAAAATTCACTTACACCTCCTGCCTTTGTAGTTCTGGTATTCACTTTACTATGTGATAGAAGTAGCATGTTGCTGCCAGAATACAAGCATTGCTTTTGGCAAATTAAAGTGCATGTCATTTCTTAATACACTAGAAAGGGGAAATAAATTAAAGTACACAAGTCCAAGTCTAAAACTTTAGTACTTTTCCATGCAGATTTGTGCACATGTGAGAGGGTGTCCAGTTTGTCTAGTGATTGTTATTTAGAGAGTTGGACCACTATTGTGTGTTGCTAATCATTGACTGTAGTCCCAAAAAAGCCTTGTGAAAATGTTATGCCCTATGTAACAGCAGAGTAACATAAAATAAAAGTACATTTTATAAACCATTTACTATGGCTTTGTAACAATTGCATACCCATATTTTAAGGGACAGGTGAATTTACTACTTTCTAAAGTTTATTGATACTTCCCTTTTATGTAAAATGTAGTAGTGATACCTATATTTCCACATTGTGCATTGTGACACACTTGTCTAGGGATGCCTGGAAGTGTATAAAATTGGACTGCATTTCTTAGAGTGTTTTACTATAGATCAGTCTCATGGGCCATCTCTTCCTCAGATGTAAATGATATCTGGTTAAGTGTTATATGGAATAAAGTGGACATTTTAAAACTAGCAAAG