Transcript asmbl_20942

Sequence
Transcript Sequence for observation asmbl_20942 of TGE0011861:
CACAGCTGTGTTTCTGTCTGGTTTTTACTTCATTTCCAGGTTCTCTCGACACCTCGCTAGCCCAGCTGGTAAAGAATGAAGGGAAAGGAGCAAAGAGGAAAACCTCTGAGGAAGAGAAGAATGGCAGTGAAGAGCTTGTGGAAAAGAAAGTTTGTAAAGCCTCTTCAGTGATCTTCAGTTTGAAAGGCTACGTGGCCGAGCGGAAGGGCGAGCGGGAGGAGATGCAGGACGCCCACGTCATCCTGAATGACATCACCGAGGAGTGCGGGCCCCCGTCATCCCTCATTACCCGGGTTTCTTATTTTGCTGTTTTCGATGGACATGGAGGAATTAGAGCCTCAAAATTTGCTGCACAGAATTTGCATCAGAACTTAATCAGGAAATTTCCTAAAGGGGATGTAATCAGTGTAGAGAAAACCGTGAAGAGATGCCTTTTGGACACTTTTAAGCATACCGATGAAGAGTTCCTTAAACAAGCCTCAAGCCAGAAGCCTGCCTGGAAAGATGGGTCCACTGCCACGTGTGTTCTGGCTGTAGACAACACTCTTTATATTGCCAACCTCGGAGATAGCCGGGCCATCCTGTGTCGCTACAACGAGGAGAGCCAGAAGCATGCCGCCTTAAGCCTCAGCAAGGAGCACAATCCTACACAGTATGAGGAACGGATGAGAATACAGAAGGCTGGAGGGAATGTCAGGGATGGGCGTGTCTTGGGTGTGCTGGAAGTGTCCCGCTCCATTGGGGATGGGCAGTACAAGCGCTGTGGGGTCACCTCCGTGCCAGACATCAGACGCTGCCAGCTGACCCCCAATGACAGGTTCATTTTGCTGGCCTGCGACGGCCTCTTCAAGGTCTTTACCCCAGAGGAAGCTGTGAACTTCATCTTGTCTTGCCTCGAGGATGAGAAGATCCAGAGCCGGGAAGGGAAGCCCGCTGTCGACGTCCGCTACGAAGCGGCCTGCAACAGGCTGGCCAGCAAGGCAGTGCAGCGGGGCTCGGCCGACAACGTCACCGTGATGGCGGTGCGGATCGGGCCCTGAGGGCGCCGCGAGGCCGGGCCCGGTGCGGCATTGGCCAAGGTCATGTGTGTGTGCACATCTGTGTGTTTCGCGTACTCCTGTGGGACTCTCGTGGTTGTAAATAAAGGTTCTTTTTTTTTTCTAGTCTTTTGAACTAATACGTTTTGAGCAGCCCTCGACCCTTCAGAGGTTAGGTGTTTGGTTTGGAATATGCTCTGGGTCTCGTTAAAACCACCGTGGCGACTTGGAGT