Transcript asmbl_31259

Sequence
Transcript Sequence for observation asmbl_31259 of TGE0001351:
AGGGGTCTGAGGCGACAGATTCCGGAAAGGGGAAGAGCAGCCAACATGGCGGCGGAACGCGGCGCGGGGCAGCAACAGTCGCAGGAGATGATGGAGGTTGACAGGCGGGTCGAGTCTGAAGAATCCGGCGATGAAGAAGGGAAGAAACACAGCAGTGGCATCGTGGCCGACCTCAGTGAACAGAGCCTGAAGGATGGGGAGGAGCGGGGGGAGGAGGACCCAGAAGAAGAACATGAGCTGCCTGTGGACATGGAAACCATCAACCTGGACAGAGATGCAGAGGATGTTGATTTGAATCACTATCGCATAGGGAAGATTGAAGGATTTGAGGTACTGAAGAAAGTGAAGACTCTCTGCCTCCGCCAAAATTTAATTAAATGCATTGAGAATCTGGAGGAGCTACAGAGTCTTCGAGAGCTGGATCTTTACGACAACCAGATCAAGAAGATTGAGAATCTGGAGGCGCTAACAGAGCTGGAGATTCTAGATATTTCTTTTAATCTGCTGAGAAACATCGAAGGGGTTGACAAGTTGACACGACTGAAAAAACTCTTCTTGGTCAACAATAAAATCAGTAAAATTGAGAACTTAAGCAACTTACATCAACTACAGATGCTAGAGCTGGGATCTAACCGCATCCGGGCAATCGAAAATATCGACACCTTAACCAACCTGGAGAGTTTGTTTTTGGGGAAAAACAAAATTACTAAACTTCAGAACCTGGATGCGCTCACCAACCTGACAGTCCTCAGTATGCAGAGCAACCGGCTGACCAAGATCGAGGGTCTGCAGAACCTGGTGAACCTGCGGGAGCTGTACCTTAGCCACAATGGCATCGAGGTCATCGAGGGCCTGGAGAACAATAACAAACTCACGATGTTGGACATTGCATCAAATAGAATCAAAAAGATTGAAAATATCAGCCATCTAACAGAGCTGCAAGAGTTCTGGATGAACGACAATCTCCTTGAGAGCTGGAGCGACCTCGACGAGCTGAAGGGAGCCAGGAGCCTGGAGACAGTGTACCTGGAGCGGAACCCCTTGCAGAAGGACCCCCAGTACCGGCGGAAGGTCATGCTCGCCCTCCCCTCCGTGCGGCAGATCGATGCCACGTTCGTCAGGTTCTGAGTCCTTCTTGGCTCCTCATGTGGTCCCTCTCCTCGGAAGAACTGCCCAGCCACGGGTTTTTAACCCACCTGTTGCTCCTGAGGTCGTCACTATATCAACAGTCACAAACCCAATGGCAATAAAGGCACTGACGATAGCTGGCGCGCGCGACGTCACACACCATTTTCAGATGCCGTTGCAATTAAATCTTGCCACACTGTCCTCCTGGGTGATTGTTGACAGTTATTGTAGCCACAGAGAGAACATAAGACACGTTGCGTTCATTCGCTAGAAATCCCTGTTTCCTTCTCTCAGAAGGCAGTCACAGTCCCTACCTGAGTCGTGTGAAACACAGGGCCTGAGAGTGCTTTACAGGCATTCACGTGCTGTCCGAGTGGCATTCGGGGGCTGGCCTAGCTGGCCCTAGTCCTGGTG