Transcript asmbl_20370

Sequence
Transcript Sequence for observation asmbl_20370 of TGE0004071:
GCTTGCGCGTCACCTGACGTGCTTGACAGTCCGTAGCCGGCGCCGAGTCAGCTGGTTTTGGAATTGCGCTGCGTGCCTGCGGGTTGGGGTTCTCTGGTCCCGCCGGCCCCGCCGCAGCCATGTCGTTCTTCCCGGAGCTTTACTTCAACGTGGACAATGGCTACTTGGAGGGACTGGTGCGCGGCCTAAAGGCTGGTGTGCTCAGCCAAGCCGACTACCTCAATTTGGTGCAGTGCGAGACGCTCGAGGACCTGAAGCTGCACCTGCAGAGCACTGACTACGGTAACTTCCTTGCCAATGAGGCATCACCACTGACAGTGTCAGTCATCGATGACCGGCTCAAGGAGAAGATGGTGGTAGAGTTCCGCCACATGAGGAACCATGCCTACGAGCCACTCGCCAGCTTCCTGGACTTTATTACTTACAGCTACATGATTGACAACGTGATCCTACTCATCACGGGCACGCTGCACCAGCGCTCTATCGCCGAGCTTGTGCCCAAGTGCCACCCACTAGGCAGCTTTGAGCAGATGGAGGCCGTGAACATTGCGCAGACACCTGCTGAGCTCTACAATGCTATTCTGGTGGACACACCCCTGGCGGCTTTTTTCCAGGACTGCATCTCAGAGCAGGACCTCGATGAGATGAACATTGAGATCATCCGCAATACGCTCTACAAGGCCTACCTGGAATCCTTCTACAAGTTCTGCACCCTACTGGGCGGGACCACAGCTGATGCCATGTGCCCCATCCTGGAGTTTGAAGCAGACCGCCGCGCCTTCATCATCACCATCAACTCCTTTGGCACAGAACTGTCTAAAGAGGATCGTGCAAAGCTCTTTCCACACTGTGGGCGGCTCTACCCAGAGGGCCTGGCCCAGCTGGCTCGGGCTGATGACTACGAACAAGTCAAGAACGTGGCTGACTACTACCCGGTGAGTGCCCTGGCTACAGGACAGTGGGTGAGCGTATTGGCACCTACATACCCACACCCAACAATGCCCTTATGCTCATGCTTCCCACCACTCCCCTGGGCCAGGAGTATAAGCTGCTCTTTGAAGGAGCAGGGAGCAACCCCGGAGACAAGACCCTGGAGGACCGATTCTTTGAGCATGAGGTGAAACTGAACAAGTTGGCCTTCCTGAACCAGTTTCACTTTGGTGTCTTTTACGCCTTTGTGAAGCTCAAGGAGCAGGAGTGTCGCAACATTGTATGGATTGCCGAGTGCATTGCCCAGCGTCACCGCGCCAAGATCGACAACTATATCCCCATCTTCTAGTGCCCTGGCCCAAGGCTCCCCATAAGTGTGTGTGTGTCTGTGCTGTGACCGAGGCTCCAGCTCACCTGCCTGTTCTGGGGGTAGCACATTGTCTTAGTGGCTGCCCAGTTTCCCTGACACTCTGCTCTTGGGCCTGAAAAGAGGCTGAGTACCTGTTCTCCCCACCAAGGATGGATGGACCAAGGCCCCACCTCCAGATCAAGGAGGCCCCTCAGTCCTGTTTACAGCCACTGACATGTCTGAGAAGCATGTGGTCACTTTTGTGTCCTTCCCTAACCTGAGAATCACTGGGGGCAACATGAGCCTCCTCTCTCCTTTATGGGTCAACCCCAGAGACATGGCCCAGGGGAAGGATAGTGTGTGTCTTTGAGGCATGGGGGTGCATCCCCCTCCTTCAGCTCTGCCCTTCAACAATAAACTGCCCTCTCCAAA