Transcript asmbl_13265

Sequence
Transcript Sequence for observation asmbl_13265 of TGE0000133:
CCGCGGGTCGCGGGCGGATGACGCGCCGGGGCCGGCGGAGGAGCAGCCACTTCCTGGGGCCGCCGGCCGGGGCCGCTGGCTGCACTCAGCGCCGGAGCCGGGAGCTAGCGGCCGCCGCCATGTCCCACCAGACCGGCATCCAAGCAAGTGAAGATGTTAAAGAGATCTTTGCCAGAGCCAGAAATGGAAAGTACAGACTTCTGAAAATATCTATTGAAAATGAGCAACTTGTGATTGGATCATATAGTCAGCCTTCAGATTCCTGGGATAAGGATTATGATTCCTTTGTTTTACCCCTGTTGGAGGACAAACAACCATGCTATATATTATTCAGGTTAGATTCTCAGAATGCCCAGGGATATGAATGGATATTCATTGCATGGTCTCCAGATCATTCTCATGTTCGTCAAAAAATGTTGTATGCAGCAACAAGAGCAACTCTGAAGAAGGAATTTGGAGGTGGCCACATTAAAGATGAAGTATTTGGAACAGTAAAGGAAGATGTATCATTACATGGATATAAAAAATACTTGCTGTCACAATCTTCCCCTGCCCCACTGACTGCAGCTGAGGAAGAACTACGACAGATTAAAATCAATGAGGTACAGACTGACGTGGGTGTGGACACTAAGCATCAAACACTACAAGGAGTAGCATTTCCCATTTCTCGAGAAGCCTTTCAGGCTTTGGAAAAATTGAATAATAGACAGCTCAACTATGTGCAGTTGGAAATAGATATAAAAAATGAAATTATAATTTTGGCCAACACAACAAATACAGAACTGAAAGATTTGCCAAAGAGGATTCCCAAGGATTCAGCTCGTTACCATTTCTTTCTGTATAAACATTCCCATGAAGGAGACTATTTAGAGTCCATAGTTTTTATTTATTCAATGCCTGGATACACATGCAGTATAAGAGAGCGGATGCTGTATTCTAGCTGCAAGAGCCGTCTGCTAGAAATTGTAGAAAGACAACTACAAATGGATGTAATTAGAAAGATCGAGATAGACAATGGGGATGAGTTGACTGCAGACTTCCTTTATGAAGAAGTACATCCCAAGCAGCATGCACACAAGCAAAGTTTTGCAAAACCAAAAGGTCCTGCAGGAAAAAGAGGAATTCGAAGACTAATTAGGGGCCCAGCGGAAACTGAAGCTACTACTGATTAAAGTCATCACATTAAACATTGTAATACTAGTTTTTTAAAAGTCCAGCTTTTAGTACAGGAGAACTGAAATCATTCCATGTTGATATAAAGTAGGGAAAAAAATTGTACTTTTTGGAAAATAGCACTTTTCACTTCTGTGTGTTTTTAAAATTAATGTTATAGAAGACTCATGATTTCTATTTTTGAGTTAAAGCTAGAAAAGGGTTCAACATAATGTTTAATTTTGTCACACTGTTTTCATAGCGTTGATTCCACACTTCAAATACTTCTTAAAATTTTATACAGTTGGGCCAGTTCTAGAAAGTCTGATGTCTCAAAGGGTAAACTTACTACTTTCTTGTGGGACAGAAAGACCTTAAAATATTCATATTACTTAATGAATATGTTAAGGACCAGGCTAGAGTATTTTCTAAGCTGGAAACTTAGTGTGCCTTGGAAAAGGCCGCAAGTTGCTTACTCCGAGTAGCTGTGCTAGCTCTGTCAGACTGTAGGATCATGTCTGCAACTTTTAGAAATAGTGCTTTATATTGCAGCAGTCTTTTATATTTGACTTTTTTTTAATAGCATTAAAATTGCAGATCAGCTCACTCTGAAACTTTAAGGGTACCAGATATTTTCTATACTGCAGGATTTCTGATGACATTGAAAGACTTTAAACAGCCTTAGTAAATTATCTTTCTAATGCTCTGTGAGGCCAAACATTTATGTTCAGATTGAAATTTAAATTAATATCATTCAAAAGGAAACAAAAAATGTTGAGTTTTAAAAATCAGGATTGACTTTTTTCTCCAAAACCATACATTTATGGGCAAATTGTGTTCTTTATCACTTCCGAGCAAATACTCAGATTTAAAATTACTTTAAAGTCCTGGTACTTAACAGGCTAACGTAGATAAACACCTTAATAATCTCAGTTAATACTGTATTTCAAAACACATTTAACTGTTTTCTAATGCTTTGCATTATCAGTTACAACCTAGAGAGATTTTGAGCCTCATATTTCTTTGATACTTGAAATAGAGGGAGCTAGAACACTTAATGTTTAATCTGTTAAACCTGCTGCAAGAGCCATAACTTTGAGGCATTTTCTAAATGAACTGTGGGGATCCAGGATTTGTAATTTCTTGATCTAAACTTTATGCTGCATAAATCACTTATCGGAAATGCACATTTCATAGTGTGAAGCACTCATTTCTAAACCTTATTATCTAAGGTAATATATGCACCTTTCAGAAATTTGTGTTCGAGTAAGTAAAGCATATTAGAATAATTGTGGGTTGACAGATTTTTAAAATAGAATTTAGAGTATTTGGGGTTTTGTTTGTTTACAAATAATCAGACTATAATATTTAAACATGCAAAATAACTGACAATAATGTTGCACTTGTTTACTAAAGATATAAGTTGTTCCATGGGTGTACACGTAGACAGACACACATACACCCAAATTATTGCATTAAGAATCCTGGAGCAGACCATAGCTGAAGCTGTTATTTTCAGTCAGGAAGACTACCTGTCATGAAGGTATAAAATAATTTAGAAGTGAATGTTTTTCTGTACCATCTATGTGCAATTATACTCTAAATTCCACTACACTACATTAAAGTAAATGGACATTCCAGAATATAGATGTGATTATAGTCTTAAACTAATTATTATTAAACCAATGATTGCTGAAAATCAGTGATGCATTTGTTATAGAGTATAACTCATCGTTTACAGTATGTTTTAGTTGGCAGTATCATACCTAGATGGTGAATAACATATTCCCAGTAAATTTATATAGCAGTGAAGAATTACATGCCTTCTGGTGGACATTTTATAAGTGCATTTTATATCACAATAAAAATTTTTTCTCTTTAA