Transcript asmbl_20329

Sequence
Transcript Sequence for observation asmbl_20329 of TGE0004064:
GGGCCTGGCCGCTCTAGCCTCGACCGGGGGAAGTCACTGTCCTTACCTTCAGCCGGAGCCCGCGCTTCGGTGGATGAGCCCGCTCGCCCTCCGCTCCGTCCCGCAGCTACCCACTGCCCGCCTGCCTCCCGCTATGGCCCTGCTGCACTCCAGCCGCGTCCTGTCCGGGGTCGCCGCCGCCTTCCACCCAGGCCTGGCGGCTGCGGCTTCCGCCAGAGCCAGCTCCTGGTGGGCCCATGTGGAGATGGGGCCCCCAGATCCCATCCTGGGAGTCACAGAAGCCTATAAGAGAGACACCAACAGCAAAAAGATGAATCTGGGAGTTGGTGCCTACCGGGATGATAATGGAAAGCCTTATGTGCTCCCTAGTATCCGGAAGGCAGAGGCCCAGATTGCTGCAAAAAATTTGGACAAAGAATACCTGCCCATTGGAGGACTTGCTGAATTTTGTAAGGCATCTGCAGAGCTAGCCCTGGGTGAGAACAGTGAAGTACTGAAAAGTGGCCGGTATGTCACCCTGCAGACCATTTCTGGAACTGGGGCCTTAAGGATCGGAGCCAGTTTTCTGCAAAGATTTTTCAAGTTCAGCAGAGATATCTTTCTGCCGAAACCATCCTGGGGAAATCACACACCCATCTTCAGGGACGCCAGCATGCAGCTACAGGGTTATCGATACTATGACCCCAAGACGTGTGGCTTTGACTTCACAGGTGCTGTGGAGGACATTTCAAAAATTCCACAGCAAAGTGTTCTTCTTCTGCACGCCTGTGCCCACAATCCCACAGGGGTGGACCCTCGCCCCGAACAGTGGAAGGAGATAGCAGCAGTGGCAAAGAAAAACAATCTCTTTGTCTTCTTCGACATGGCCTACCAAGGCTTTGCCAGTGGTGACAGTAACAAAGATGCCTGGGCCGTACGCCACTTCATCGAACAAGGCATTAATGTTTGTCTCTGCCAATCCTATGCCAAGAACATGGGCTTATACGGTGAGCGTGTGGGAGCCTTCACTATGATCTGCAAGGATGCTGATGAAGCCAAAAGGGTAGAGTCACAGTTGAAGATCTTGATTCGCCCCATGTATTCCAACCCTCCTCTCAATGGAGCCCGAATTGCCTCCACCATTCTAAACAGCCCTGACCTCCGAAAACAATGGTTGCAAGAAGTGAAAGGCATGGCTGACCGCATCATCGGCATGCGGACTCAGCTGGTCTCCAACCTCAAGAAGGAGGGGTCCTCCCACAACTGGCAGCACATCACCGACCAGATCGGCATGTTCTGTTTTACAGGACTAAAGCCTGAACAGGTGGAGCGGCTGATCAAGGAGTTCTCCATCTACATGACAAAGGATGGCCGCATCTCTGTGGCAGGGGTCACCTCAGGCAACGTGGGCTACCTTGCCCATGCCATTCACCAGGTCACCAAGTAATTTCCCTGGTGAGACAGAACAGAGACAACCTTCCAGTCGACCTCTGCTGTTGTGAGATTCACAGAGGAAGCAGGAGGGTGGACGGTGGTGAGCGGAATCATTTCTTTCAACCACAGTACTTAAAACTCAGCGTTTGAATGCGTTTCTCAGAAAAGAATGTGTAGAGAAATAGAAGCATCTGTGGCTGGTGTGTGGAACTTTGTGGCTGTAAACCAAACCCTCCCTCATCTTTGTATCTCCAGCTTTTCCGAAAAGAGTTTACATGTACAAGAAAGTCGTAGCCAAAAAATTTTATCAATCACACCATTGCAATATTTCAGAAGCTTTAATTGAAGCACCTTATGGTGTTGGTCTGGAATGAAAATACCACTTATTAGAGGCTTTGTGAGAAGACCTAGTTCTAACATTGTCAGCCTCCTGTTTGTCCTGTAATTGAGCAACCTTATCAACAGACCACATTACAGAAACTGTGTGTTTTGAAAACCAGCACGTCTATTGCCACTGCAGCAAGTTCGGGAGCGGGGGGAGATGCAATTTCCATTTTTATTTAAGAAAAAGAAAGAAGACTCTCCTTTTTAGTTCTTGCAGGCATTTTAATGTCCCTCTGTCCTCCCTTATCACTGTTGTTCTTTTTCTCAGGCACTAAGATCTATAACTAGCCTAGATTTTTATCCCTTCTACTGCTGGATTGACCGTCAGCTCCATCCTATAGCATATACTTATTTGAAGAAAAGAACATGATTTACTGCTCACCCCGTGCCCTCCCCTTTCTCGGTAAAGAATAGCAGAGAATAAGTAACTGCACTTATTTTGCCATCCCCTTCAGTGATTGTCTCCTGCGGGATGTCGCCTCTGCCCAGTTGGACCTAGTACCTTAATTCAGTGCTGTTGAGCAGTCACTCATCTCACGTCACGAGTCGGGCGATATGAGGTAGAACCAGGAAAGAAGTTATTCTGGGATTTGGTCTTAACCTTTGTGTGCTGCCAGCTGGGCTCAGGCTTCACCCTTTGGAAAGATATCCACCATCTGCTCTAATCGTGTAGACTTACTGCAGCCTGGTTTCTCTGTTACAATAAAGTTACCGTAGACCCG