Transcript asmbl_20326

Sequence
Transcript Sequence for observation asmbl_20326 of TGE0011814:
CCGCGACGTGAGCGCGCGACCTCCGGCGCCATTTTGTAGAGAAACAAGCGGAGTTAACCGAAGAGGGGGGTCGAGGAGAGCCGGAGTCGGGGACCCAGGAGTTTCCTGTGTCCAGCGCCACCGGAACCGCCTGAGGTGCCATGTTTCAGAACAGAGTAAGACCCCTGGTAAAGAAGAACTGAAGACACTGTATAGACACCAGATATAGGCTAATTACAAAGAAAGCATTAACCTGCCTCTGAGGTGACTAAAGGGGAATAATGGTGATTTTGCGCCGGGCTCGGCCGCCTGCTTCCGCCCCAACCAGCAATGAATCTTGACTCGCTCTCGCTGGCCTTGTCTCAAATCAGCTACCTGGTGGACAATTTAACCAAGAAAAACTACCGAGCCAGCCAGCAGGAAATACAGCATATTGTGAATCGGCACGGTCCTGAGGCAGACAGGCATTTATTACGCTGCCTATTTTCGCATGTGGATTTCAGTGGCGATGGTAAAAGCAGTGGCAAAGATTTTCATCAGACTCAGTTTCTGATTCAGGAGTGTGCGTCGCTGATTACAAAGCCAAATTTTATCTCCACGCTGTCCTATGCCATTGATAATCCATTGCACTATCAGAAGAGTTTAAAGCCTGCACCCCACTTATTTGCCCAGCTGAGTAAAGTTCTCAAGTTAAGCAAAGTACAAGAGGTAATTTTTGGCCTTGCCCTCTTGAATTCTTCCAGCTCAGATCTCAGAGGTTTTGCTGCCCAGTTTATCAAACAGAAGCTTCCAGATCTTCTGCGTTCTTACATTGACGCAGACGTCAGTGGAAATCAAGAAGGTGGCTTCCAAGATATAGCCATAGAGGTCCTACACCTCCTCCTCTCCCATCTCCTTTTTGGGCAGAAGGGAGCCTTTGGAGTTGGACAGGAGCAGATAGACGCTTTCCTTAAGACGCTGCGCAGAGATTTTCCCCAGGAACGCTGTCCTGTGGTGCTTGCACCACTTTTATACCCTGAAAAACGGGACATTCTAATGGACAGGATCCTGCCTGATTCTGGAGGGGTAGCTAAAACCATGATGGAGAGCTCTTTGGCTGATTTTATGCAAGAAGTAGGCTATGGCTTTTGTGCAAGTATTGAAGAATGTCGCAATATAATCATGCAATTTGGTGTTCGGGAAGTCACAGCTGCCCAGGTTGCAAGGGTTTTGGGAATGATGGCTCGAACTCATTCAGGATTAACAGATGGAATTCCATTACAGAGTATCTCTGCTCCTGGCAGTGGGATCTGGAGTGATGGAAAAGATAAAAGTGATGGAGCACAGGCACACACGTGGAATGTAGAAGTCTTGATTGATGTTCTCAAAGAACTGAACCCGAGTTTGAATTTCAAGGAAGTAACTTATGAACTGGACCATCCTGGATTTCAAATTCGTGACAGTAAAGGACTTCATAATGTGGTTTATGGCATTCAAAGGGGTCTGGGAATGGAAGTGTTCCCAGTAGACCTCATATATAGACCTTGGAAACATGCAGAAGGCCAGCTCTCCTTCATTCAGCATTCCCTTATAAATCCAGAGATCTTCTGTTTTGCTGACTATCCCTGTCATACTGTTGCCACTGATATTCTGAAAGCACCACCAGAGGATGACAATCGAGAAATTGCCACATGGAAGAGCTTGGATTTGATTGAATCTCTACTGAGGCTCGCAGAGGTGGGGCAATATGAGCAAGTCAAACAGCTCTTCAGCTTTCCTATCAAACACTGTCCAGACATGTTGGTATTGGCCTTACTACAAATCAACACCTCCTGGCACACCTTGCGCCATGAGCTCATCTCCACTCTGATGCCAATTTTCCTCGGAAACCATCCTAACTCTGCTATTATTTTGCACTATGCATGGCATGGGCAGGGACAGTCTCCCTCAATCCGCCAGCTTATCATGCATGCAATGGCAGAGTGGTACATGCGAGGGGAGCAGTATGATCAGGCCAAATTGTCTCGAATACTTGATGTGGCCCAGGACTTGAAGGCCTTGTCAATGCTGCTAAATGGTACTCCATTTGCCTTTGTTATTGACCTTGCTGCACTTGCTTCACGTCGTGAATACCTCAAACTTGACAAGTGGCTCACAGATAAAATTCGAGAGCATGGAGAGCCTTTTATCCAGGCATGCATGACTTTTTTAAAGAGACGGTGCCCTTCTATTTTGGGTGGACTCGCCCCAGAGAAAGATCAGCCCAAAAGTGCTCAACTTCCTCCAGAAACTCTGGCGACAATGTTGGCCTGTTTACAAGCTTGTGCAGGGAGTGTTTCTCAGGAGTTATCAGAAACCATCCTCACCATGGTAGCCAATTGCAGTAATGTTATGAATAAGGCCAGACAACCGCCACCTGGAGTTATGCCAAAAGGACGCCCTCCTAGTGCTAGCAGCTTAGATGCCATTTCTCCTGTTCAGATTGACCCTCTAGCTGGAATGGCATCTCTTAGTATAGGTGGTTCAGCTGCCCCTCACACCCAGAGTATGCAGGGTTTTCCACCAAATTTGGGTTCTGCATTCAGTACCCCTCAGTCACCAGCAAAAGCATTTCCACCCCTTTCTACCCCAAATCAAACAACTGCATTCAGTGGTATTGGAGGACTTTCATCACAGCTCCCAGTAGGTGGTCTTGGCACAGGCAGCCTGACTGGTATAGGAACTGGGGCTCTTGGACTCCCTGCAGTGAATAACGATCCTTTTGTACAGAGGAAACTGGGCACCTCTGGACTGAACCAGCCTACATTCCAGCAGAGTAAGATGAAACCTTCGGACTTGTCTCAGGTGTGGCCAGAGGCAAACCAGCACTTTAGTAAAGAGATAGACGATGAAGCAAACAGCTATTTCCAGAGAATATATAATCACCCACCACATCCAACTATGTCTGTTGATGAGGTATTAGAAATGCTACAGAGGTTTAAAGACTCTACCATAAAGAGAGAACGAGAAGTATTTAATTGTATGCTAAGGAACTTGTTTGAAGAATATCGGTTTTTCCCCCAGTACCCTGATAAAGAGTTACATATAACAGCCTGCCTGTTTGGTGGGATAATTGAAAAAGGACTGGTCACTTACATGGCACTAGGTCTGGCCCTGCGATATGTTCTTGAAGCCTTACGCAAGCCTTTTGGATCCAAAATGTATTATTTCGGGATTGCTGCACTAGATAGATTTAAAAATAGATTGAAGGACTATCCCCAGTATTGTCAGCACTTGGCTTCTATCAGTCACTTTATGCAGTTTCCACATCATTTACAGGAGTATATTGAGTATGGACAGCAGTCTAGAGATCCTCCTGTGAAAATGCAGGGCTCCATCACAACACCCGGAAGTATTGCACTGGCTCAGGCTCAGGCTCAGGCCCAGGTTCCAGCAAAAGCACCCCTTGCTGGTCAGGTTAGCACTATGGTAACCACCTCAACAACCACCACTGTTGCTAAAACGGTTACAGTCACCAGGCCAACTGGAGTCAGCTTTAAGAAAGATGTGCCACCTTCTATTAATACTACAAATATAGATACATTGCTTGTGGCCACAGATCAAACTGAAAGAATTGTAGAGCCCCCAGAAAATATCCAGGAGAAAATTGCATTTATCTTCAACAATCTCTCACAGTCGAATATGACACAAAAGGTTGAAGAACTCAAGGAAACTGTGAAGGAAGAATTTATGCCTTGGGTTTCACAGTACCTGGTTATGAAGAGAGTCAGTATTGAGCCAAACTTTCACAGCTTGTATTCAAACTTCCTTGACACGCTGAAGAATCCTGAATTTAATAAGATGGTTCTAAATGAGACCTACAGAAACATCAAAGTTCTCCTGACCTCTGATAAAGCTGCAGCCAATTTCTCAGATCGTTCTTTGCTGAAGAACTTGGGACATTGGCTGGGAATGATTACACTAGCTAAAAATAAACCCATCTTACATACTGACTTGGATGTGAAATCTTTGCTGCTAGAGGCTTACGTTAAAGGACAGCAAGAATTGCTCTATGTAGTACCCTTTGTTGCCAAAGTCTTAGAGTCTAGCATTCGTAGTGTGGTTTTTAGGCCACCCAACCCCTGGACAATGGCAATTATGAATGTATTAGCTGAGCTACATCAGGAACATGACTTAAAGTTAAACTTGAAGTTTGAGATTGAGGTCCTCTGCAAGAACCTTGCATTAGACATCAATGAGCTAAAACCTGGAAACCTCCTAAAGGATAAAGATCGCCTAAAGAACTTAGATGAGCAACTCTCTGCTCCAAAGAAAGATGTCAAACAGCCAGAAGAACTCCCTCCCATCACAACCACAACAACTTCTACGACACCAGCTACCAGTACCACCTGTACAGCCACGGTTCCACCACAGCCACAGTACAGCTACCATGACATCAATGTCTATTCCCTCGCAGGCCTGGCACCACACATTACTCTAAACCCAACAATTCCCTTGTTTCAGGCCCATCCGCAGTTGAAGCAGTGTGTGCGTCAAGCAATTGAACGGGCTGTCCAGGAGTTGGTCCATCCTGTGGTGGATCGATCAATTAAGATTGCCATGACTACTTGTGAGCAAATAGTCAGGAAGGATTTTGCCCTGGATTCTGAGGAATCTCGAATGCGAATAGCAGCTCATCACATGATGCGTAACTTGACAGCTGGCATGGCTATGATTACTTGCAGGGAACCTTTGCTCATGAGCATATCTACAAATCTGAAAAACAGTTTTGCCTCAGCTCTTCGTACTGCATCCCCACAACAAAGGGAAATGATGGATCAGGCAGCTGCTCAGTTAGCTCAGGACAATTGTGAATTAGCCTGCTGTTTTATTCAGAAGACTGCAGTAGAAAAAGCAGGCCCTGAGATGGACAAGAGATTAGCAACTGAATTTGAGCTGAGAAAACATGCTAGGCAAGAAGGGCGCAGGTACTGTGATCCTGTTGTGTTAACATACCAAGCTGAGCGGATGCCAGAGCAAATCAGATTGAAAGTGAGAATTGGGGGCTGTGTCTCTTCTTGCCCCATCTGTTTTCTTTCTGTTCTTGTTGCTTCAACTCCTTACCAGGACTAGGACAGTGAGGTTAAATGTTGTTTCAGAG