Transcript asmbl_20325

Sequence
Transcript Sequence for observation asmbl_20325 of TGE0011813:
CCGCGACGTGAGCGCGCGACCTCCGGCGCCATTTTGTAGAGAAACAAGCGGAGTTAACCGAAGAGGGGGGTCGAGGAGAGCCGGAGTCGGGGACCCAGGAGTTTCCTGTGTCCAGCGCCACCGGAACCGCCTGAGGTGCCATGTTTCAGAACAGAGTAAGACCCCTGGTAAAGAAGAACTGAAGACACTGTATAGACACCAGATATAGGCTAATTACAAAGAAAGCATTAACCTGCCTCTGAGGTGACTAAAGGGGAATAATGGTGATTTTGCGCCGGGCTCGGCCGCCTGCTTCCGCCCCAACCAGCAATGAATCTTGACTCGCTCTCGCTGGCCTTGTCTCAAATCAGCTACCTGGTGGACAATTTAACCAAGAAAAACTACCGAGCCAGCCAGCAGGAAATACAGCATATTGTGAATCGGCACGGTCCTGAGGCAGACAGGCATTTATTACGCTGCCTATTTTCGCATGTGGATTTCAGTGGCGATGGTAAAAGCAGTGGCAAAGATTTTCATCAGACTCAGTTTCTGATTCAGGAGTGTGCGTCGCTGATTACAAAGCCAAATTTTATCTCCACGCTGTCCTATGCCATTGATAATCCATTGCACTATCAGAAGAGTTTAAAGCCTGCACCCCACTTATTTGCCCAGCTGAGTAAAGTTCTCAAGTTAAGCAAAGTACAAGAGGTAATTTTTGGCCTTGCCCTCTTGAATTCTTCCAGCTCAGATCTCAGAGGTTTTGCTGCCCAGTTTATCAAACAGAAGCTTCCAGATCTTCTGCGTTCTTACATTGACGCAGACGTCAGTGGAAATCAAGAAGGTGGCTTCCAAGATATAGCCATAGAGGTCCTACACCTCCTCCTCTCCCATCTCCTTTTTGGGCAGAAGGGAGCCTTTGGAGTTGGACAGGAGCAGATAGACGCTTTCCTTAAGACGCTGCGCAGAGATTTTCCCCAGGAACGCTGTCCTGTGGTGCTTGCACCACTTTTATACCCTGAAAAACGGGACATTCTAATGGACAGGATCCTGCCTGATTCTGGAGGGGTAGCTAAAACCATGATGGAGAGCTCTTTGGCTGATTTTATGCAAGAAGTAGGCTATGGCTTTTGTGCAAGTATTGAAGAATGTCGCAATATAATCATGCAATTTGGTGTTCGGGAAGTCACAGCTGCCCAGGTTGCAAGGGTTTTGGGAATGATGGCTCGAACTCATTCAGGATTAACAGATGGAATTCCATTACAGAGTATCTCTGCTCCTGGCAGTGGGATCTGGAGTGATGGAAAAGATAAAAGTGATGGAGCACAGGCACACACGTGGAATGTAGAAGTCTTGATTGATGTTCTCAAAGAACTGAACCCGAGTTTGAATTTCAAGGAAGTAACTTATGAACTGGACCATCCTGGATTTCAAATTCGTGACAGTAAAGGACTTCATAATGTGGTTTATGGCATTCAAAGGGGTCTGGGAATGGAAGTGTTCCCAGTAGACCTCATATATAGACCTTGGAAACATGCAGAAGGCCAGCTCTCCTTCATTCAGCATTCCCTTATAAATCCAGAGATCTTCTGTTTTGCTGACTATCCCTGTCATACTGTTGCCACTGATATTCTGAAAGCACCACCAGAGGATGACAATCGAGAAATTGCCACATGGAAGAGCTTGGATTTGATTGAATCTCTACTGAGGCTCGCAGAGGTGGGGCAATATGAGCAAGTCAAACAGCTCTTCAGCTTTCCTATCAAACACTGTCCAGACATGTTGGTATTGGCCTTACTACAAATCAACACCTCCTGGCACACCTTGCGCCATGAGCTCATCTCCACTCTGATGCCAATTTTCCTCGGAAACCATCCTAACTCTGCTATTATTTTGCACTATGCATGGCATGGGCAGGGACAGTCTCCCTCAATCCGCCAGCTTATCATGCATGCAATGGCAGAGTGGTACATGCGAGGGGAGCAGTATGATCAGGCCAAATTGTCTCGAATACTTGATGTGGCCCAGGACTTGAAGGCCTTGTCAATGCTGCTAAATGGTACTCCATTTGCCTTTGTTATTGACCTTGCTGCACTTGCTTCACGTCGTGAATACCTCAAACTTGACAAGTGGCTCACAGATAAAATTCGAGAGCATGGAGAGCCTTTTATCCAGGCATGCATGACTTTTTTAAAGAGACGGTGCCCTTCTATTTTGGGTGGACTCGCCCCAGAGAAAGATCAGCCCAAAAGTGCTCAACTTCCTCCAGAAACTCTGGCGACAATGTTGGCCTGTTTACAAGCTTGTGCAGGGAGTGTTTCTCAGGAGTTATCAGAAACCATCCTCACCATGGTAGCCAATTGCAGTAATGTTATGAATAAGGCCAGACAACCGCCACCTGGAGTTATGCCAAAAGGACGCCCTCCTAGTGCTAGCAGCTTAGATGCCATTTCTCCTGTTCAGATTGACCCTCTAGCTGGAATGGCATCTCTTAGTATAGGTGGTTCAGCTGCCCCTCACACCCAGAGTATGCAGGGTTTTCCACCAAATTTGGGTTCTGCATTCAGTACCCCTCAGTCACCAGCAAAAGCATTTCCACCCCTTTCTACCCCAAATCAAACAACTGCATTCAGTGGTATTGGAGGACTTTCATCACAGCTCCCAGGTGGTCTTGGCACAGGCAGCCTGACTGGTATAGGAACTGGGGCTCTTGGACTCCCTGCAGTGAATAACGATCCTTTTGTACAGAGGAAACTGGGCACCTCTGGACTGAACCAGCCTACATTCCAGCAGAGTAAGATGAAACCTTCGGACTTGTCTCAGGTGTGGCCAGAGGCAAACCAGCACTTTAGTAAAGAGATAGACGATGAAGCAAACAGCTATTTCCAGAGAATATATAATCACCCACCACATCCAACTATGTCTGTTGATGAGGTATTAGAAATGCTACAGAGGTTTAAAGACTCTACCATAAAGAGAGAACGAGAAGTATTTAATTGTATGCTAAGGAACTTGTTTGAAGAATATCGGTTTTTCCCCCAGTACCCTGATAAAGAGTTACATATAACAGCCTGCCTGTTTGGTGGGATAATTGAAAAAGGACTGGTCACTTACATGGCACTAGGTCTGGCCCTGCGATATGTTCTTGAAGCCTTACGCAAGCCTTTTGGATCCAAAATGTATTATTTCGGGATTGCTGCACTAGATAGATTTAAAAATAGATTGAAGGACTATCCCCAGTATTGTCAGCACTTGGCTTCTATCAGTCACTTTATGCAGTTTCCACATCATTTACAGGAGTATATTGAGTATGGACAGCAGTCTAGAGATCCTCCTGTGAAAATGCAGGGCTCCATCACAACACCCGGAAGTATTGCACTGGCTCAGGCTCAGGCTCAGGCCCAGGTTCCAGCAAAAGCACCCCTTGCTGGTCAGGTTAGCACTATGGTAACCACCTCAACAACCACCACTGTTGCTAAAACGGTTACAGTCACCAGGCCAACTGGAGTCAGCTTTAAGAAAGATGTGCCACCTTCTATTAATACTACAAATATAGATACATTGCTTGTGGCCACAGATCAAACTGAAAGAATTGTAGAGCCCCCAGAAAATATCCAGGAGAAAATTGCATTTATCTTCAACAATCTCTCACAGTCGAATATGACACAAAAGGTTGAAGAACTCAAGGAAACTGTGAAGGAAGAATTTATGCCTTGGGTTTCACAGTACCTGGTTATGAAGAGAGTCAGTATTGAGCCAAACTTTCACAGCTTGTATTCAAACTTCCTTGACACGCTGAAGAATCCTGAATTTAATAAGATGGTTCTAAATGAGACCTACAGAAACATCAAAGTTCTCCTGACCTCTGATAAAGCTGCAGCCAATTTCTCAGATCGTTCTTTGCTGAAGAACTTGGGACATTGGCTGGGAATGATTACACTAGCTAAAAATAAACCCATCTTACATACTGACTTGGATGTGAAATCTTTGCTGCTAGAGGCTTACGTTAAAGGACAGCAAGAATTGCTCTATGTAGTACCCTTTGTTGCCAAAGTCTTAGAGTCTAGCATTCGTAGTGTGGTTTTTAGGCCACCCAACCCCTGGACAATGGCAATTATGAATGTATTAGCTGAGCTACATCAGGAACATGACTTAAAGTTAAACTTGAAGTTTGAGATTGAGGTCCTCTGCAAGAACCTTGCATTAGACATCAATGAGCTAAAACCTGGAAACCTCCTAAAGGATAAAGATCGCCTAAAGAACTTAGATGAGCAACTCTCTGCTCCAAAGAAAGATGTCAAACAGCCAGAAGAACTCCCTCCCATCACAACCACAACAACTTCTACGACACCAGCTACCAGTACCACCTGTACAGCCACGGTTCCACCACAGCCACAGTACAGCTACCATGACATCAATGTCTATTCCCTCGCAGGCCTGGCACCACACATTACTCTAAACCCAACAATTCCCTTGTTTCAGGCCCATCCGCAGTTGAAGCAGTGTGTGCGTCAAGCAATTGAACGGGCTGTCCAGGAGTTGGTCCATCCTGTGGTGGATCGATCAATTAAGATTGCCATGACTACTTGTGAGCAAATAGTCAGGAAGGATTTTGCCCTGGATTCTGAGGAATCTCGAATGCGAATAGCAGCTCATCACATGATGCGTAACTTGACAGCTGGCATGGCTATGATTACTTGCAGGGAACCTTTGCTCATGAGCATATCTACAAATCTGAAAAACAGTTTTGCCTCAGCTCTTCGTACTGCATCCCCACAACAAAGGGAAATGATGGATCAGGCAGCTGCTCAGTTAGCTCAGGACAATTGTGAATTAGCCTGCTGTTTTATTCAGAAGACTGCAGTAGAAAAAGCAGGCCCTGAGATGGACAAGAGATTAGCAACTGAATTTGAGCTGAGAAAACATGCTAGGCAAGAAGGGCGCAGGTACTGTGATCCTGTTGTGTTAACATACCAAGCTGAGCGGATGCCAGAGCAAATCAGATTGAAAGTTGGTGGTGTGGACCCAAAGCAGCTGGCTGTTTATGAAGAATTTGCACGCAATGTGCCTGGCTTCTTGCCTACTAATGATTTAAGTCAGCCCACGGGATTTTTAGCTCAGCCTATGAAGCAAGCTTGGGCAACAGATGATGTAGCTCAAATTTATGATAAGTGCATTACAGAACTGGAGCAGCACCTACATGCCATCCCACCAACATTGGCCATGAACCCTCAAGCTCAGGCTCTGAGAAGTCTTTTGGAGGTTGTAGTTTTATCTCGAAACTCTCGGGATGCCATAGCTGCTCTTGGATTGCTCCAGAAGGCTGTAGAGGGCTTACTAGATGCCACAAGTGGTGCTGATGCTGATCTGCTGCTGCGCTATAGGGAATGCCACCTCTTGGTCTTAAAAGCTCTTCAAGATGGCCGTGCATATGGGTCTCCGTGGTGTAACAAACAGATCACAAGGTGCCTAATTGAATGTCGAGATGAATATAAATATAATGTGGAGGCAGTGGAGTTGCTAATTCGCAATCATTTGGTTAATATGCAGCAGTATGATCTTCACCTAGCTCAGTCAATGGAGAATGGTTTAAACTACATGGCTGTGGCATTTGCTATGCAATTGGTAAAAATCCTGCTGGTGGATGAAAGGAGTGTTGCCCATATTACTGAGGCAGATCTGTTCCACACCATTGAAACCCTCATGAGAATTAATGCTCACTCCAGAGGCAATGCTCCAGAAGGATTGCCCCAGCTGATGGAAGTAGTGCGATCCAACTATGAAGCAATGATTGATCGTGCTCATGGAGGCCCTAACTTTATGATGCATTCTGGGATTTCTCAAGCCTCAGAGTATGATGATCCTCCAGGCCTGAGGGAGAAAGCAGAGTACCTTCTGAGGGAATGGGTGAATCTCTACCATTCAGCAGCAGCTGGCCGTGACAGTACCAAAGCTTTCTCTGCGTTTGTTGGACAGGTAGAGCTTTTGGAAAGAAAGATGCACCAGCAAGGAATCCTGAAGACTGATGACCTCATAACAAGGTTTTTTCGTCTGTGTACTGAAATGTGTGTTGAAATCAGTTACCGTGCTCAGGCAGAGCAGCAGCACAATCCTGCTGCTAATCCCACCATGATCCGAGCCAAGTGCTATCACAACCTGGATGCCTTTGTTCGACTCATTGCACTGCTAGTGAAGCACTCAGGGGAGGCCACCAACACTGTCACAAAGATTAATCTGCTGAACAAGGTCCTTGGTATAGTAGTGGGAGTTCTCCTACAGGATCATGATGTTCGGCAAAGTGAATTTCAGCAGCTTCCCTACCATCGAATATTTATCATGCTGCTCTTGGAACTCAATGCACCTGAGCATGTACTAGAAACCATTAATTTCCAGACACTTACAGCTTTCTGCAATACATTCCACATCTTGAGGCCTACCAAAGCTCCAGGCTTTGTGTATGCCTGGCTCGAACTGATCTCCCATCGGATATTTATTGCAAGAATGCTGGCACATACGCCACAGCAGAAGGGATGGCCTATGTATGCACAGCTACTGATTGATTTATTCAAATATTTAGCACCTTTCCTTAGAAATGTGGAACTCACCAAACCTATGCAAATCCTCTACAAGGGCACTTTAAGAGTGCTGCTGGTTCTTTTGCATGATTTCCCTGAGTTCCTTTGTGATTACCATTATGGATTCTGTGATGTGATCCCACCTAATTGTATCCAGCTAAGAAATCTGATACTGAGTGCCTTCCCAAGAAACATGAGGCTCCCAGACCCATTTACTCCCAATCTGAAGGTGGATATGTTGAGTGAAATTAATATTGCGCCCCGGATTCTCACCAATTTTACTGGAGTGATGCCACCTCAGTTCAAAAAGGATTTGGATTCCTATCTTAAAACTCGATCACCGGTCACTTTTCTATCTGATCTGCGCAGCAACTTACAGGTGTCCAATGAGCCTGGCAATCGCTACAACCTCCAGCTCATCAATGCACTGGTGCTCTATGTAGGGACTCAGGCCATTGCACACATCCACAACAAGGGCAGCACACCTTCAATGAGCACGATCACCCACTCGGCTCACATGGACATATTCCAGAACCTGGCTGTGGACTTGGACACTGAAGGCCGGTATCTCTTTTTGAATGCAATTGCAAATCAGCTGCGGTACCCAAATAGCCACACTCACTACTTCAGCTGCACCATGCTGTATCTCTTTGCAGAGGCCAACACTGAAGCTATCCAAGAACAGATCACAAGGGTTCTCTTGGAACGGTTGATTGTAAATAGGCCACATCCTTGGGGTCTTCTTATTACCTTCATTGAGCTGATTAAAAATCCAGCATTTAAGTTCTGGAACCACGAGTTTGTACACTGTGCCCCAGAAATTGAAAAGTTATTCCAGTCGGTTGCACAGTGCTGCATGGGACAGAAGCAGGCTCAACAAGTAATGGAAGGGACCGGTGCCAGTTAGATGGAACTTCATCTCTGTTGCCTGGCTGTCCCAAGTTCATAAACTGGCTGAAGAATCATTTCAGCTCTTCCTGACGTTCTCAGCCCTTTGGTTCTCGGGTATCTGCCCCAATTACTCTTTGGGTCAGCTTCCTGTCTATGTGGGCAAGTTCCAAAGTTTAAATGCATTTTTTGACTCTTGGCCAAAATTTAGAAGATGCTGTGAATATCATTTTGAACTTGTGTAAATATATGACAGAGAAAACCTTTGTCTGGAACTTCTTGGGTTTGTGCAAAATGTGTCCAAGGCAAGTAGATAAACTGGTACCTGCTCAGCTTGTAACTGAAGAAGCTGCTGATGCCATGTGCTTGTCTGGGGACATAGCTCCATATCTTCTGACATTCCTGATGTCCCAAAGAATAGCAAAAAAGCCAGTTTAAATATTATGTAACTTATTTTTTTAATGAGGACAGGGGACCTTGAAAATCAAAGTTTTTAAAAATGTGGTTATGCTAGAATTTGGTATGTCAGGGAACCTGGTAGAGCTCACAATTGCAATCCCATGAGTTTTTGTTTTGCATCCTCCCCCGATCTATAGTTGACTGCTTGAGACCATACCACTTGGGCCCTGTGAGACACAGCTCTTTTTAAAATAAAGGGAAACCAGGCCAGGCCTAAAGCTCCCCATCTCTCCTGATAACTTGTAAAACTGTGAGGAAAGGGAACCAAATAGTATGAATTGCTCTCCATTATCCCAGGCTCAGTTGAACAAAAGTCAAAAGGACCAATACAGCCCCTTTTGTAAGGATTTTGAATGTTTTGTAAATGTATTGGTCCATGTGTTGTATTTTGTAGCCTTTCTAGTTCCTGGGCTTTTAGCTCCCCTACTTCTTTTCTTCTATGTATGTGCATACTGCAGTCAAACATTAAAAGTCATGCCACACATGTGAGTCCACTGTGCCTTTCTCAGTAGCAGCAGCCAGTGCTGGTGGTGAGGAGGGACGTGGACAACCCACCCTTGCAAAGCCTGGGGCCTTTGGGGAACACCGGCTTCTTGCTAATGGTAGATCTTCCCCACTACTAACTAGTCTGGCATGTTTAAACAAGCGATAAAGTGATTTATTTCTTCCTGTTCCTTGTCACTAGTGGAAAATTGTGAGAGTGGGTTTCTATAGTTAAATAATTATAAAATGCCCATTTTTAAATATCCTGTTCCCTCATTTTGATATAATTTTTAAA