Transcript asmbl_20323

Sequence
Transcript Sequence for observation asmbl_20323 of TGE0004063:
CCGCGACGTGAGCGCGCGACCTCCGGCGCCATTTTGTAGAGAAACAAGCGGAGTTAACCGAAGAGGGGGGTCGAGGAGAGCCGGAGTCGGGGACCCAGGAGTTTCCTGTGTCCAGCGCCACCGGAACCGCCTGAGGTGCCATGTTTCAGAACAGAGTAAGACCCCTGGTAAAGAAGAACTGAAGACACTGTATAGACACCAGATATAGGCTAATTACAAAGAAAGCATTAACCTGCCTCTGAGGTGACTAAAGGGGAATAATGGTGATTTTGCGCCGGGCTCGGCCGCCTGCTTCCGCCCCAACCAGCAATGAATCTTGACTCGCTCTCGCTGGCCTTGTCTCAAATCAGCTACCTGGTGGACAATTTAACCAAGAAAAACTACCGAGCCAGCCAGCAGGAAATACAGCATATTGTGAATCGGCACGGTCCTGAGGCAGACAGGCATTTATTACGCTGCCTATTTTCGCATGTGGATTTCAGTGGCGATGGTAAAAGCAGTGGCAAAGATTTTCATCAGACTCAGTTTCTGATTCAGGAGTGTGCGTCGCTGATTACAAAGCCAAATTTTATCTCCACGCTGTCCTATGCCATTGATAATCCATTGCACTATCAGAAGAGTTTAAAGCCTGCACCCCACTTATTTGCCCAGCTGAGTAAAGTTCTCAAGTTAAGCAAAGTACAAGAGGTAATTTTTGGCCTTGCCCTCTTGAATTCTTCCAGCTCAGATCTCAGAGGTTTTGCTGCCCAGTTTATCAAACAGAAGCTTCCAGATCTTCTGCGTTCTTACATTGACGCAGACGTCAGTGGAAATCAAGAAGGTGGCTTCCAAGATATAGCCATAGAGGTCCTACACCTCCTCCTCTCCCATCTCCTTTTTGGGCAGAAGGGAGCCTTTGGAGTTGGACAGGAGCAGATAGACGCTTTCCTTAAGACGCTGCGCAGAGATTTTCCCCAGGAACGCTGTCCTGTGGTGCTTGCACCACTTTTATACCCTGAAAAACGGGACATTCTAATGGACAGGATCCTGCCTGATTCTGGAGGGGTAGCTAAAACCATGATGGAGAGCTCTTTGGCTGATTTTATGCAAGAAGTAGGCTATGGCTTTTGTGCAAGTATTGAAGAATGTCGCAATATAATCATGCAATTTGGTGTTCGGGAAGTCACAGCTGCCCAGGTTGCAAGGGTTTTGGGAATGATGGCTCGAACTCATTCAGGATTAACAGATGGAATTCCATTACAGAGTATCTCTGCTCCTGGCAGTGGGATCTGGAGTGATGGAAAAGATAAAAGTGATGGAGCACAGGCACACACGTGGAATGTAGAAGTCTTGATTGATGTTCTCAAAGAACTGAACCCGAGTTTGAATTTCAAGGAAGTAACTTATGAACTGGACCATCCTGGATTTCAAATTCGTGACAGTAAAGGACTTCATAATGTGGTTTATGGCATTCAAAGGGGTCTGGGAATGGAAGTGTTCCCAGTAGACCTCATATATAGACCTTGGAAACATGCAGAAGGCCAGCTCTCCTTCATTCAGCATTCCCTTATAAATCCAGAGATCTTCTGTTTTGCTGACTATCCCTGTCATACTGTTGCCACTGATATTCTGAAAGCACCACCAGAGGATGACAATCGAGAAATTGCCACATGGAAGAGCTTGGATTTGATTGAATCTCTACTGAGGCTCGCAGAGGTGGGGCAATATGAGCAAGTCAAACAGCTCTTCAGCTTTCCTATCAAACACTGTCCAGACATGTTGGTATTGGCCTTACTACAAATCAACACCTCCTGGCACACCTTGCGCCATGAGCTCATCTCCACTCTGATGCCAATTTTCCTCGGAAACCATCCTAACTCTGCTATTATTTTGCACTATGCATGGCATGGGCAGGGACAGTCTCCCTCAATCCGCCAGCTTATCATGCATGCAATGGCAGAGTGGTACATGCGAGGGGAGCAGTATGATCAGGCCAAATTGTCTCGAATACTTGATGTGGCCCAGGACTTGAAGGCCTTGTCAATGCTGCTAAATGGTACTCCATTTGCCTTTGTTATTGACCTTGCTGCACTTGCTTCACGTCGTGAATACCTCAAACTTGACAAGTGGCTCACAGATAAAATTCGAGAGCATGGAGAGCCTTTTATCCAGGCATGCATGACTTTTTTAAAGAGACGGTGCCCTTCTATTTTGGGTGGACTCGCCCCAGAGAAAGATCAGCCCAAAAGTGCTCAACTTCCTCCAGAAACTCTGGCGACAATGTTGGCCTGTTTACAAGCTTGTGCAGGGAGTGTTTCTCAGGAGTTATCAGAAACCATCCTCACCATGGTAGCCAATTGCAGTAATGTTATGAATAAGGCCAGACAACCGCCACCTGGAGTTATGCCAAAAGGACGCCCTCCTAGTGCTAGCAGCTTAGATGCCATTTCTCCTGTTCAGATTGACCCTCTAGCTGGAATGGCATCTCTTAGTATAGGTGGTTCAGCTGCCCCTCACACCCAGAGTATGCAGGGTTTTCCACCAAATTTGGGTTCTGCATTCAGTACCCCTCAGTCACCAGCAAAAGCATTTCCACCCCTTTCTACCCCAAATCAAACAACTGCATTCAGTGGTATTGGAGGACTTTCATCACAGCTCCCAGGTGGTCTTGGCACAGGCAGCCTGACTGGTATAGGAACTGGGGCTCTTGGACTCCCTGCAGTGAATAACGATCCTTTTGTACAGAGGAAACTGGGCACCTCTGGACTGAACCAGCCTACATTCCAGCAGACGGACTTGTCTCAGGTGTGGCCAGAGGCAAACCAGCACTTTAGTAAAGAGATAGACGATGAAGCAAACAGCTATTTCCAGAGAATATATAATCACCCACCACATCCAACTATGTCTGTTGATGAGGTATTAGAAATGCTACAGAGGTTTAAAGACTCTACCATAAAGAGAGAACGAGAAGTATTTAATTGTATGCTAAGGAACTTGTTTGAAGAATATCGGTTTTTCCCCCAGTACCCTGATAAAGAGTTACATATAACAGCCTGCCTGTTTGGTGGGATAATTGAAAAAGGACTGGTCACTTACATGGCACTAGGTCTGGCCCTGCGATATGTTCTTGAAGCCTTACGCAAGCCTTTTGGATCCAAAATGTATTATTTCGGGATTGCTGCACTAGATAGATTTAAAAATAGATTGAAGGACTATCCCCAGTATTGTCAGCACTTGGCTTCTATCAGTCACTTTATGCAGTTTCCACATCATTTACAGGAGTATATTGAGTATGGACAGCAGTCTAGAGATCCTCCTGTGAAAATGCAGGGCTCCATCACAACACCCGGAAGTATTGCACTGGCTCAGGCTCAGGCTCAGGCCCAGGTTCCAGCAAAAGCACCCCTTGCTGGTCAGGTTAGCACTATGGTAACCACCTCAACAACCACCACTGTTGCTAAAACGGTTACAGTCACCAGGCCAACTGGAGTCAGCTTTAAGAAAGATGTGCCACCTTCTATTAATACTACAAATATAGATACATTGCTTGTGGCCACAGATCAAACTGAAAGAATTGTAGAGCCCCCAGAAAATATCCAGGAGAAAATTGCATTTATCTTCAACAATCTCTCACAGTCGAATATGACACAAAAGGTTGAAGAACTCAAGGAAACTGTGAAGGAAGAATTTATGCCTTGGGTTTCACAGTACCTGGTTATGAAGAGAGTCAGTATTGAGCCAAACTTTCACAGCTTGTATTCAAACTTCCTTGACACGCTGAAGAATCCTGAATTTAATAAGATGGTTCTAAATGAGACCTACAGAAACATCAAAGTTCTCCTGACCTCTGATAAAGCTGCAGCCAATTTCTCAGATCGTTCTTTGCTGAAGAACTTGGGACATTGGCTGGGAATGATTACACTAGCTAAAAATAAACCCATCTTACATACTGACTTGGATGTGAAATCTTTGCTGCTAGAGGCTTACGTTAAAGGACAGCAAGAATTGCTCTATGTAGTACCCTTTGTTGCCAAAGTCTTAGAGTCTAGCATTCGTAGTGTGGTTTTTAGGCCACCCAACCCCTGGACAATGGCAATTATGAATGTATTAGCTGAGCTACATCAGGAACATGACTTAAAGTTAAACTTGAAGTTTGAGATTGAGGTCCTCTGCAAGAACCTTGCATTAGACATCAATGAGCTAAAACCTGGAAACCTCCTAAAGGATAAAGATCGCCTAAAGAACTTAGATGAGCAACTCTCTGCTCCAAAGAAAGATGTCAAACAGCCAGAAGAACTCCCTCCCATCACAACCACAACAACTTCTACGACACCAGCTACCAGTACCACCTGTACAGCCACGGTTCCACCACAGCCACAGTACAGCTACCATGACATCAATGTCTATTCCCTCGCAGGCCTGGCACCACACATTACTCTAAACCCAACAATTCCCTTGTTTCAGGCCCATCCGCAGTTGAAGCAGTGTGTGCGTCAAGCAATTGAACGGGCTGTCCAGGAGTTGGTCCATCCTGTGGTGGATCGATCAATTAAGATTGCCATGACTACTTGTGAGCAAATAGTCAGGAAGGATTTTGCCCTGGATTCTGAGGAATCTCGAATGCGAATAGCAGCTCATCACATGATGCGTAACTTGACAGCTGGCATGGCTATGATTACTTGCAGGGAACCTTTGCTCATGAGCATATCTACAAATCTGAAAAACAGTTTTGCCTCAGCTCTTCGTACTGCATCCCCACAACAAAGGGAAATGATGGATCAGGCAGCTGCTCAGTTAGCTCAGGACAATTGTGAATTAGCCTGCTGTTTTATTCAGAAGACTGCAGTAGAAAAAGCAGGCCCTGAGATGGACAAGAGATTAGCAACTGAATTTGAGCTGAGAAAACATGCTAGGCAAGAAGGGCGCAGGTACTGTGATCCTGTTGTGTTAACATACCAAGCTGAGCGGATGCCAGAGCAAATCAGATTGAAAGTTGGTGGTGTGGACCCAAAGCAGCTGGCTGTTTATGAAGAATTTGCACGCAATGTGCCTGGCTTCTTGCCTACTAATGATTTAAGTCAGCCCACGGGATTTTTAGCTCAGCCTATGAAGCAAGCTTGGGCAACAGATGATGTAGCTCAAATTTATGATAAGTGCATTACAGAACTGGAGCAGCACCTACATGCCATCCCACCAACATTGGCCATGAACCCTCAAGCTCAGGCTCTGAGAAGTCTTTTGGAGGTTGTAGTTTTATCTCGAAACTCTCGGGATGCCATAGCTGCTCTTGGATTGCTCCAGAAGGCTGTAGAGGGCTTACTAGATGCCACAAGTGGTGCTGATGCTGATCTGCTGCTGCGCTATAGGGAATGCCACCTCTTGGTCTTAAAAGCTCTTCAAGATGGCCGTGCATATGGGTCTCCGTGGTGTAACAAACAGATCACAAGGTGCCTAATTGAATGTCGAGATGAATATAAATATAATGTGGAGGCAGTGGAGTTGCTAATTCGCAATCATTTGGTTAATATGCAGCAGTATGATCTTCACCTAGCTCAGTCAATGGAGAATGGTTTAAACTACATGGCTGTGGCATTTGCTATGCAATTGGTAAAAATCCTGCTGGTGGATGAAAGGAGTGTTGCCCATATTACTGAGGCAGATCTGTTCCACACCATTGAAACCCTCATGAGAATTAATGCTCACTCCAGAGGCAATGCTCCAGAAGGATTGCCCCAGCTGATGGAAGTAGTGCGATCCAACTATGAAGCAATGATTGATCGTGCTCATGGAGGCCCTAACTTTATGATGCATTCTGGGATTTCTCAAGCCTCAGAGTATGATGATCCTCCAGGCCTGAGGGAGAAAGCAGAGTACCTTCTGAGGGAATGGGTGAATCTCTACCATTCAGCAGCAGCTGGCCGTGACAGTACCAAAGCTTTCTCTGCGTTTGTTGGACAGATGCACCAGCAAGGAATCCTGAAGACTGATGACCTCATAACAAGGTTTTTTCGTCTGTGTACTGAAATGTGTGTTGAAATCAGTTACCGTGCTCAGGCAGAGCAGCAGCACAATCCTGCTGCTAATCCCACCATGATCCGAGCCAAGTGCTATCACAACCTGGATGCCTTTGTTCGACTCATTGCACTGCTAGTGAAGCACTCAGGGGAGGCCACCAACACTGTCACAAAGATTAATCTGCTGAACAAGGTCCTTGGTATAGTAGTGGGAGTTCTCCTACAGGATCATGATGTTCGGCAAAGTGAATTTCAGCAGCTTCCCTACCATCGAATATTTATCATGCTGCTCTTGGAACTCAATGCACCTGAGCATGTACTAGAAACCATTAATTTCCAGACACTTACAGCTTTCTGCAATACATTCCACATCTTGAGGCCTACCAAAGCTCCAGGCTTTGTGTATGCCTGGCTCGAACTGATCTCCCATCGGATATTTATTGCAAGAATGCTGGCACATACGCCACAGCAGAAGGGATGGCCTATGTATGCACAGCTACTGATTGATTTATTCAAATATTTAGCACCTTTCCTTAGAAATGTGGAACTCACCAAACCTATGCAAATCCTCTACAAGGGCACTTTAAGAGTGCTGCTGGTTCTTTTGCATGATTTCCCTGAGTTCCTTTGTGATTACCATTATGGATTCTGTGATGTGATCCCACCTAATTGTATCCAGCTAAGAAATCTGATACTGAGTGCCTTCCCAAGAAACATGAGGCTCCCAGACCCATTTACTCCCAATCTGAAGGTGGATATGTTGAGTGAAATTAATATTGCGCCCCGGATTCTCACCAATTTTACTGGAGTGATGCCACCTCAGTTCAAAAAGGATTTGGATTCCTATCTTAAAACTCGATCACCGGTCACTTTTCTATCTGATCTGCGCAGCAACTTACAGGTGTCCAATGAGCCTGGCAATCGCTACAACCTCCAGCTCATCAATGCACTGGTGCTCTATGTAGGGACTCAGGCCATTGCACACATCCACAACAAGGGCAGCACACCTTCAATGAGCACGATCACCCACTCGGCTCACATGGACATATTCCAGAACCTGGCTGTGGACTTGGACACTGAAGGCCGGTATCTCTTTTTGAATGCAATTGCAAATCAGCTGCGGTACCCAAATAGCCACACTCACTACTTCAGCTGCACCATGCTGTATCTCTTTGCAGAGGCCAACACTGAAGCTATCCAAGAACAGATCACAAGGGTTCTCTTGGAACGGTTGATTGTAAATAGGCCACATCCTTGGGGTCTTCTTATTACCTTCATTGAGCTGATTAAAAATCCAGCATTTAAGTTCTGGAACCACGAGTTTGTACACTGTGCCCCAGAAATTGAAAAGTTATTCCAGTCGGTTGCACAGTGCTGCATGGGACAGAAGCAGGCTCAACAAGTAATGGAAGGGACCGGTGCCAGTTAGATGGAACTTCATCTCTGTTGCCTGGCTGTCCCAAGTTCATAAACTGGCTGAAGAATCATTTCAGCTCTTCCTGACGTTCTCAGCCCTTTGGTTCTCGGGTATCTGCCCCAATTACTCTTTGGGTCAGCTTCCTGTCTATGTGGGCAAGTTCCAAAGTTTAAATGCATTTTTTGACTCTTGGCCAAAATTTAGAAGATGCTGTGAATATCATTTTGAACTTGTGTAAATATATGACAGAGAAAACCTTTGTCTGGAACTTCTTGGGTTTGTGCAAAATGTGTCCAAGGCAAGTAGATAAACTGGTACCTGCTCAGCTTGTAACTGAAGAAGCTGCTGATGCCATGTGCTTGTCTGGGGACATAGCTCCATATCTTCTGACATTCCTGATGTCCCAAAGAATAGCAAAAAAGCCAGTTTAAATATTATGTAACTTATTTTTTTAATGAGGACAGGGGACCTTGAAAATCAAAGTTTTTAAAAATGTGGTTATGCTAGAATTTGGTATGTCAGGGAACCTGGTAGAGCTCACAATTGCAATCCCATGAGTTTTTGTTTTGCATCCTCCCCCGATCTATAGTTGACTGCTTGAGACCATACCACTTGGGCCCTGTGAGACACAGCTCTTTTTAAAATAAAGGGAAACCAGGCCAGGCCTAAAGCTCCCCATCTCTCCTGATAACTTGTAAAACTGTGAGGAAAGGGAACCAAATAGTATGAATTGCTCTCCATTATCCCAGGCTCAGTTGAACAAAAGTCAAAAGGACCAATACAGCCCCTTTTGTAAGGATTTTGAATGTTTTGTAAATGTATTGGTCCATGTGTTGTATTTTGTAGCCTTTCTAGTTCCTGGGCTTTTAGCTCCCCTACTTCTTTTCTTCTATGTATGTGCATACTGCAGTCAAACATTAAAAGTCATGCCACACATGTGAGTCCACTGTGCCTTTCTCAGTAGCAGCAGCCAGTGCTGGTGGTGAGGAGGGACGTGGACAACCCACCCTTGCAAAGCCTGGGGCCTTTGGGGAACACCGGCTTCTTGCTAATGGTAGATCTTCCCCACTACTAACTAGTCTGGCATGTTTAAACAAGCGATAAAGTGATTTATTTCTTCCTGTTCCTTGTCACTAGTGGAAAATTGTGAGAGTGGGTTTCTATAGTTAAATAATTATAAAATGCCCATTTTTAAATATCCTGTTCCCTCATTTTGATATAATTTTTAAA