Transcript asmbl_20322

Sequence
Transcript Sequence for observation asmbl_20322 of TGE0011811:
TTCTTTAATGTGGCTTAAGAATGCAAGATAAAAAAGCATGACTATAGAGAGGGGTAAGGGAATTATCTTCTTGCTTTACGAGCTCTAATCTATGTGCTTTGTAGGTCCTTGGTATAGTAGTGGGAGTTCTCCTACAGGATCATGATGTTCGGCAAAGTGAATTTCAGCAGCTTCCCTACCATCGAATATTTATCATGCTGCTCTTGGAACTCAATGCACCTGAGCATGTACTAGAAACCATTAATTTCCAGACACTTACAGCTTTCTGCAATACATTCCACATCTTGAGGCCTACCAAAGCTCCAGGCTTTGTGTATGCCTGGCTCGAACTGATCTCCCATCGGATATTTATTGCAAGAATGCTGGCACATACGCCACAGCAGAAGGGATGGCCTATGTATGCACAGCTACTGATTGATTTATTCAAATATTTAGCACCTTTCCTTAGAAATGTGGAACTCACCAAACCTATGCAAATCCTCTACAAGGGCACTTTAAGAGTGCTGCTGGTTCTTTTGCATGATTTCCCTGAGTTCCTTTGTGATTACCATTATGGATTCTGTGATGTGATCCCACCTAATTGTATCCAGCTAAGAAATCTGATACTGAGTGCCTTCCCAAGAAACATGAGGCTCCCAGACCCATTTACTCCCAATCTGAAGGTGGATATGTTGAGTGAAATTAATATTGCGCCCCGGATTCTCACCAATTTTACTGGAGTGATGCCACCTCAGTTCAAAAAGGATTTGGATTCCTATCTTAAAACTCGATCACCGGTCACTTTTCTATCTGATCTGCGCAGCAACTTACAGGTGTCCAATGAGCCTGGCAATCGCTACAACCTCCAGCTCATCAATGCACTGGTGCTCTATGTAGGGACTCAGGCCATTGCACACATCCACAACAAGGGCAGCACACCTTCAATGAGCACGATCACCCACTCGGCTCACATGGACATATTCCAGAACCTGGCTGTGGACTTGGACACTGAAGGCCGGTATCTCTTTTTGAATGCAATTGCAAATCAGCTGCGGTACCCAAATAGCCACACTCACTACTTCAGCTGCACCATGCTGTATCTCTTTGCAGAGGCCAACACTGAAGCTATCCAAGAACAGATCACAAGGGTTCTCTTGGAACGGTTGATTGTAAATAGGCCACATCCTTGGGGTCTTCTTATTACCTTCATTGAGCTGATTAAAAATCCAGCATTTAAGTTCTGGAACCACGAGTTTGTACACTGTGCCCCAGAAATTGAAAAGTTATTCCAGTCGGTTGCACAGTGCTGCATGGGACAGAAGCAGGCTCAACAAGTAATGGAAGGGACCGGTGCCAGTTAGATGGAACTTCATCTCTGTTGCCTGGCTGTCCCAAGTTCATAAACTGGCTGAAGAATCATTTCAGCTCTTCCTGACGTTCTCAGCCCTTTGGTTCTCGGGTATCTGCCCCAATTACTCTTTGGGTCAGCTTCCTGTCTATGTGGGCAAGTTCCAAAGTTTAAATGCATTTTTTGACTCTTGGCCAAAATTTAGAAGATGCTGTGAATATCATTTTGAACTTGTGTAAATATATGACAGAGAAAACCTTTGTCTGGAACTTCTTGGGTTTGTGCAAAATGTGTCCAAGGCAAGTAGATAAACTGGTACCTGCTCAGCTTGTAACTGAAGAAGCTGCTGATGCCATGTGCTTGTCTGGGGACATAGCTCCATATCTTCTGACATTCCTGATGTCCCAAAGAATAGCAAAAAAGCCAGTTTAAATATTATGTAACTTATTTTTTTAATGAGGACAGGGGACCTTGAAAATCAAAGTTTTTAAAAATGTGGTTATGCTAGAATTTGGTATGTCAGGGAACCTGGTAGAGCTCACAATTGCAATCCCATGAGTTTTTGTTTTGCATCCTCCCCCGATCTATAGTTGACTGCTTGAGACCATACCACTTGGGCCCTGTGAGACACAGCTCTTTTTAAAATAAAGGGAAACCAGGCCAGGCCTAAAGCTCCCCATCTCTCCTGATAACTTGTAAAACTGTGAGGAAAGGGAACCAAATAGTATGAATTGCTCTCCATTATCCCAGGCTCAGTTGAACAAAAGTCAAAAGGACCAATACAGCCCCTTTTGTAAGGATTTTGAATGTTTTGTAAATGTATTGGTCCATGTGTTGTATTTTGTAGCCTTTCTAGTTCCTGGGCTTTTAGCTCCCCTACTTCTTTTCTTCTATGTATGTGCATACTGCAGTCAAACATTAAAAGTCATGCCACACATGTGAGTCCACTGTGCCTTTCTCAGTAGCAGCAGCCAGTGCTGGTGGTGAGGAGGGACGTGGACAACCCACCCTTGCAAAGCCTGGGGCCTTTGGGGAACACCGGCTTCTTGCTAATGGTAGATCTTCCCCACTACTAACTAGTCTGGCATGTTTAAACAAGCGATAAAGTGATTTATTTCTTCCTGTTCCTTGTCACTAGTGGAAAATTGTGAGAGTGGGTTTCTATAGTTAAATAATTATAAAATGCCCATTTTTAAATATCCTGTTCCCTCATTTTGATATAATTTTTAAA