Transcript asmbl_19379

Sequence
Transcript Sequence for observation asmbl_19379 of TGE0001383:
CTCCGGGCAGTGTAAAGGCCCTTCGGTCTAAGGCTTTCCTATTTCCTGGTTCGCCGGCGGCCATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAAGGGGACGGAGTAGGGGAAGACGTTTGCTCTCCCGGAACAGCTTATCTCATTCTTTTCCTTCGATTACCCGTGGCGCGGAGAATCAGGGCGGCGGCTGCAGCAGCAAGGGCGGCGGTGGCGGCGGCGGCAGCTGCAGTGACATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGAGACTCTGGAGTTGGAAAGTCTTGCCTCCTTCTTAGATTTGCAGATGATACATATACAGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAAATAAGAACTATAGAGTTAGATGGGAAAACAATCAAGCTTCAAATTTGGGACACAGCGGGCCAAGAAAGATTTCGAACAATCACCTCCAGTTATTACAGAGGAGCGCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCTTCAATAACGTTAAACAGTGGCTGCAGGAAATAGATCGTTATGCCAGTGAAAATGTCAACAAGTTGTTGGTAGGGAACAAATGTGATCTGACCACAAAGAAAGTAGTAGACTACACAACAGCAAAGGAATTTGCTGATTCTCTTGGAATTCCATTTTTGGAAACCAGTGCTAAAAACGCAACGAATGTAGAACAATCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCTGGAGCAACAGCTGGTGGTGCAGAAAAGTCCAATGTTAAAATTCAGAGCACTCCGGTCAAGCAGTCAGGTGGAGGTTGCTGCTAAAATTTGCCTCCGTCCTTTTCTCACAGCAGTGAATTTGCAATCTGAACCCAAGTGAAAACAAAATTGCCTGAATTGTACTGTATGTAGCTGCACTACAACAGATTCTTACCGTCTCCACAAAGGTCAGAGATTGTAAATGGTCAATACTGACTTTTTTTTTATTCCCTTGACTCAAGACAGCTAACTTCATTTTCAGAACCGTTTTAAACCTTTGTGTGCTGGTTTATAAAATAATGTGTGTAATCCTTGTTGCTTTCCTGATACCAGACTGTTTCCCGTGGTTGGTTAGAATATATTTTGTTTTGATGTTTCTATTGGCATGTTTAGATGTCAGGTTTAGTCTTCTGAAGATGAAGTTCAGCCATTTTGTATCAAACAGCACAACCATTGTCTGTCACTTTCCATGCATAAAGTTTAGTGAGATGTTATATGTAAGATCTGATTTGCTAGTTCTTCCTTGTAGAGTTATAAATGGAAAGATTACACTATCTGATTAATAGTTTCTTCATACTCTGCATATAATTTGTGGCTGCAGAATATTGTAATTTGTTGCACACTATGTAACAAAACAACTGAAGATATGTTTAATAAATATTGTACTTATTGGAAGTAATATCAAACGTATGGTGATAAGTATTTTAATTCTATGGTTAAAGGGAAATAGAGCCTTTCATTATTCTTAAAACAGCCATTTCTGTGTGCAACCAGGGCATTGTAGACCTATCTTAGAGCAGCATTCAATATGTTTTCCAGATAATATATCCAATATATGACCTAGGGAGGCTTCTGTGCTGGGTAGGGATTTAACCAAGCTTAGTGGTTCAGGGAGATTAAACTGTATGAAAAGCAAGTTTAGGATGTATGCTTTCTAGCGCATTATCTTTGCTCCCTTCTCTGAAACCATTGGAAATGGTTTATTTGATCAACATTTTGTTAATTCTCTTCTGTGGTAGAGATAGAAAGCTGCACACCTTTCCTAATTGGCAAATGATCAGACTAACACATGTGCTAATTTTGTTTCTTCCATGCTGAGTCAGATGTTGACTATTTTATCCTCCACAATTATATAACAAGTTGGAGGAGAGTTAAAACATTAAAGTAGAAGGCAGGAAAAATTTACTATTTGATTGTCCTAATTTTAGAAATTATATCCTTAAAAATTAACTGAAAACACAAATGCTAGGTGGAAATGATGAGAGAAATATATTTATTTCAGTGGAATTTTGCACATGTGAAAATTTTGTTAAATAGGACCTTAAAAATCCTAGGGTTTGTTTTTATTGTGGGAAACAAAAATCTTTTGCTAACACTGGCATTTTAAGGTGATAGAAATCAAAGACTGTTTCCTTGGGATTGACGTAGCTACCAAAAACATTCTTAGAGGCTTGGGATGTGGCTGTTGGCAACACATTTTATGGTGGGGTCTTGAATTCAATGATAAAATTTAAATAAAACCAAGCCAAAAATTATAGGTTTCTTTATTTTCACTAAACAGGCAATTTAAATACATGGTACAAAAATAAGTCGTAAGATTATTGTAAAATGAAATGGACAGAATATTCAATTTAATTTTCCATCTATGAGAATTTCACAATAAAATCATAGTTTACTTTGTATTATAGATGTGCTTGTTGGATCTATTCATCCTCTCATAAGGCAACTGAAAAATTAAAGTTATCGAATAGTTATTTGGGTGAAGATTTTAAAAAATGCTTCAAAAGATCTGTTTTTTTGCCTTATAGTATAAAGGGGGAAAGACTTCAGAAACTATTTTCTAAAGTAGATAAATGATACAAATGTTAGATGTGATGCCACACACTTCAGTTTTATATAGCAAGTTGTTCACACTGTCAGCTTATTCTTGATGAGTTAGCATAAAACATGATGTGAATTTAAGATGTAAGTATATTTACATTACTTAGCTTTGAAAATGCTAGTGGTGTTCTCCCATTGCAGTAAAGACGGGCTTACCACAAGATGTTTCAGCATGCTCCACTATTTGCTTTTATGAATATGCCAATATACCCCCATTTTCAAGTACACACATTTCAA