Transcript asmbl_19309

Sequence
Transcript Sequence for observation asmbl_19309 of TGE0004025:
GCGGCAGCGGCGGCGGCGGCGGCGTGCGGGGCCCCACGGTGTAAACAGCCCCGGAGGCGGCGACCGAGACCCCGAGAGGGAAGCGGCAGCTGAGGCAGGGTCCTCGGTTGGAAGCCTGGGCTGAGTGCAGCTGGGAGCCTCTGCGGCGGCGTGAGCAGACGCCCTAGACCTCGCCTCCCTCCCTTGCCCCAGATTTATTACTAAACATGGGTGCATTTTTGGATAAACCCAAAACTGAGAAACATAATGCTCATGGTGCTGGGAATGGTTTACGTTATGGCCTGAGCAGCATGCAAGGATGGAGAGTAGAAATGGAAGATGCACACACAGCTGTTGTAGGTATTCCTCACGGCTTGGAAGACTGGTCATTTTTTGCAGTTTATGATGGTCATGCTGGATCCCGAGTAGCAAATTACTGCTCAACACATTTACTAGAACACATCACTAATAATGAAGACTTCAGGGCAACTGGAAAATCAGGATCTGCTCTTGAGCCTTCAGTGGAAAATGTCAAGAATGGTATCAGAACTGGCTTTTTGAAAATTGATGAATACATGCGTAACTTTTCAGACCTCATTAGCGGTTCAACTGCAGTGGGAGTTATGATTTCACCTAAGCATATCTACTTCATCAACTGTGGTGATTCACGTGCTGTTCTGTATAGGAATGGACAAGTCTGCTTTTCTACCCAGGATCACAAACCTTGCAATCCAAGGGAGAAGGAGCGAATCCAAAATGCAGGAGGCAGTGTAATGATTCAACGTGTTAATGGTTCATTAGCAGTATCTCGAGCTCTGGGGGACTATGATTACAAGTGTGTTGATGGCAAGGGCCCAACAGAACAACTTGTTTCTCCAGAGCCTGAGGTTTATGAACTTTTAAGAGCAGAAGAGGATGAATTTATCATCTTGGCTTGTGATGGGATCTGGGATGTTATGAGTAATGAGGAGCTCTGTGAATTTGTTAAATCTAGGCTTGAGGTATCTGATGACCTGGAAAATGTGTGCAATTGGGTAGTGGACACTTGTTTACATAAGGGAAGTCGAGATAACATGAGTATTGTACTAGTTTGCTTTTCAAATGCCCCCAAGGTCTCAGAAGAAGCAGTGAGAAAAGATTCAGAGTTGGATAAATACTTGGAATCACGGGTTGAAGAAATTATGGAGAAGTCGGGTGAGGAAGGAATGCCTGATCTTGCCCATGTAATGCGCATCTTGTCTGCAGAAAATATCCCAAATTTGCCTCCTGGGGGAGGTCTTGCTGGCAAGCGCAATGTTATTGAAGCTGTTTATAGTAGACTGAATCCACACAGAGAAAGTGATGGGGGTGCTGGAGATCTAGAAGACCCATGGTAGCCTTATAAACCTTCTAAAATGCTTTTGATTCTGAAAATTGGGGGAAAAAACTTTTAATCACAATTTTCTTCAATACAAGGGAAAAATATTCTTGTGGATTTCCAACGTTTTGTGATATGAGCAGAAAATAATTAGCATTTCCCATCATTTGTTCATATTTGTGTTTTCTGATAATTGCCACTTTGTAGCATTGCCTGTACTACAGTATTTTTGCCAACCTCAGGCATACTGGTTACATCTGTATTGAACTTTTGGCCCTAGAAACCAATGAAGTTATTTCAGCACATATAATAATTGTGCCTGAGGTGCATGGGAATATAGTTAGCTGTACTCCGAAGATACATTATGGGGTTTTTTTGTTGTTGTTTTTTGTTTTTGTTTTTTTTAACAAGACACACAACATATAAGCATGTAAGAGTAAAGAATTATACGAGATGTTCCTTTTTTCAATTCACCAAGTTGGAAGCCTTTTGCAGCTCTGTGGCTTGAAATTTCATTTGAGCATACTGTAGGATATATATTTATTATTAATTGTTATTTAATTTTTTTTTCCAATTTTACCTGTATTACCAAACTGGGTTCTCCAATAATGTCCAAATTGTAATGTTGCCTGCTTCAAGATAAAGTGTATTTGGCAATAATAATAAAACCCTTACAGGTTTTATGCATGTATTTACTACATCCTTCAATTCTCACTAGAAAATCTTTGAAACCAAATG