Transcript asmbl_18645

Sequence
Transcript Sequence for observation asmbl_18645 of TGE0003988:
CTGCACCTTGGGCTGGAAGCTGAGACGGATTCCCCAAAGATGCTCCAGTTGCAGGAGCGAAGCAAATTTATCATTGTCCCGAGGAAAGGGAGCAGCGTGATTCTTACCCGTTTCAGTAGAACGACTGGCATCCTTCAGCTGCACAAGCCAGTGCTCGGGTTGTGATTTTCCTGGGGAAAGTGGAGACCAGCACGCCTGCTTGCGCTCCTTCCCTCCTCCTGGAGCCAGCCGTGTTTGCTGCTGCGATTCGCCAACGTGCCCCTCCTCTAACTGCGGCTGGTTCCGTCTACCTCTTACACTTCATTTATCTGTAGATCATTTGGATAGCCCGTCTTGTAAATGTTTAGCATTTTGGTGTTTTACTGCTTCTTTCTGGGGGCATTTCCAGCACTTGCCGAGACCGGCGAAGGGAGGCGACTGTGCCCGGAGAAGAGCGAAATATGGGGACCTGGTCTAAAAGCAGCTGTTGTCCTTCCCGCACGCTATTTCTATATTCAGGCGGTGGATACATCAGGAGATAAGTTCAGATCTTCTCCAGGTGAAAAAGTGTTCCAGATTAAAATCACAGCACCAGATGAGCAATTCACTAGAGTTGGAGTCCAAGTTTTAGACCGAAAGGATGGGTCCTTCATAGTAAGATATAGAATGTATGCAAGCTACAAAAATCTGAAGGTAGAAGTTAAATTCCAAGGTCAACATGTGGCCAAATCTCCATATATTTTAAAAGGGCCCGTTTACCATGAGAATTGTGACTGTCCTTTGGAAGATAGTGCAGCCTGGCTACAGGAGATGAAGTGCCCAGAAACCATTGCTCAAATTCAGAGAGATCTGGCACATTTTCCTACTGTTGATCCAGAAAAGATTGCAGCAGAAATTCCAAAGAGATTTGGACAAAGGCAGAGCTTGTGTCACTATACCTTGAAGGATAACAAGGTGAAGATGCCAGATATGGAGTTTTTTGTTAATTTGGGAGACTGGCCTTTGGAAAAAAAGAAATCCAATTTACACATCCATCCAATCTTTTCCTGGTGTGGCTCCACAGATTCCAAGGATATCGTGATGCCTACCTATGACCTGACCGACTCTGTTCTAGAAACCATGGGCCGAGTAAGTCTGGATATGATGTCTGTGCAAGCTAACACGGGTCCTCCCTGGGAAAGCAAAAACTCCACAGCTGTCTGGAGAGGGCGAGACAGCCGCAAAGAGAGACTCGAGCTGGTTAAACTCAGCAGAAAACACCCAGAACTCATAGATGCTGCCTTCACCAACTTTTTCTTCTTTAAACACGATGAAAGCCTGTATGGTCCCATTGTGAAACACATTTCATTTTTTGATTTCTTCAAGCATAAGTATCAAATAAACATTGACGGCACTGTCGCAGCATATCGCCTGCCATATCTTCTAGTCGGTGACAGTGTTGTGCTGAAGCAGGACTCCATCTACTATGAACATTTTTATAATGAGCTACAGCCCTGGAAACACTACATTCCAGTTAAAAGCAACCTGAGCGATCTCCTAGAAAAACTTAAATGGGCAAAAGATCACGATGAAGAGGCAAAGAAGATTGCAAAAACAGGACAGGAATTTGCAAGAAATAATCTCATGGGTGATGACATATTCTGTTATTATTTTAAACTTTTTCAGGAATATGCTAGTTTACAAGTGAGTGAACCCCAAATCCGAGAGGGCATGAAGAGGGTAGAGCCACAGTCTGAGGATGACCTCTTTCCTTGCACGTGCCTTAGGAAAAAGACCAAAGATGAACTCTGATTTGCAAAATACCTTCCCTTCAAATAATGGTGCTCTGAAGACTCTTCTTAACTGAAAAGAAGAATTTTTTTAGAATATTAATTCTGTGGACAGTATAAAATCTATGTGATTGTCTGGGTTAAGAAGATATGTTTCTTATTATGCAGTATTCTCATGACTGTCCTTTAAAGCACATTTTTAGAATTTTATAATAAAATCACTTTTATTTTAA