Transcript asmbl_18559

Sequence
Transcript Sequence for observation asmbl_18559 of TGE0011743:
GTCAGTGATGATCATCGGTGTATGAGGGAAATGCTTGTTCTGTAACTCTCTGGTTTCTGATTGGCTCCATACTGTATCTGTAAACAGTAGACTCTCCATCTTTTACAGCTTAACCAGAGTCTCTCCTTTAACTTTATTTCTGACATGTTCTCTTTTTTTCTTATTTAGGAAACCACTGATTGCTTGTGTGGAGAAACAACTATTAGGAGAACATTTAACAGCAATTCTGCAGAAAGGGCTTGATCACTTACTTGATGAGAACAGAGTGCCTGACCTCACTCAGATGTACCAGCTGTTCAGCCGAGTAAAGGGTGGGCAGCAGATCCTGCTGCAGCACTGGAGCGACTATATTAAGACTTTTGGGACAACAATTGTTATCAATCCTGAAAAAGATAAAGATATGGTACAGGACCTGCTGGATTTTAAGGACAGAGTGGACCACGTGATAGAAGTGTGCTTTCAGAGGAATGAGAAGTTCATCAACTTGATGAAGGAATCCTTTGAAACATTTATCAACAAGAGGCCAAATAAACCCGCAGAACTGATCGCAAAGCATGTTGATTCAAAATTGAGAGCGGGTAATAAAGAAGCAACAGATGAAGAACTGGAGAGGATCCTCGACAAAATCATGATAATATTCAGGTTTATACATGGTAAAGATGTCTTTGAAGCATTTTATAAAAAAGATTTGGCAAAAAGACTCCTTGTTGGAAAAAGTGCCTCAGTTGATGCTGAAAAATCTATGTTGTCAAAACTAAAGCATGAGTGTGGCGCTGCTTTCACCAGCAAACTAGAAGGCATGTTCAAGGACATGGAGCTCTCCAAGGATATCATGGTTCATTTTAAGCAGTATATGCAGAATCAGAGTGACCCAGGCTCTATTGATCTAACAGTAAATATACTTACGATGGGATACTGGCCAACATACACACCTATGGAAGTACATTTAACTCCAGAAATGATCAAACTTCAGGAAGTGTTTAAGACATTTTACCTTGGAAAGCACAGTGGTCGAAAACTTCAATGGCAAACTACATTGGGACATGCTGTTTTAAAAGCAGAGTTTAAGGAAGGAAAGAAGGAGTTCCAGGTGTCCCTCTTCCAGACTCTGGTGCTTCTCATGTTCAACGAAGGGGACGGATTCAGCTTCGAAGATATAAAAATGGCCACTGGGATAGAGGACAGCGAATTACGAAGAACGTTACAGTCCCTGGCCTGTGGCAAAGCACGAGTTCTGATTAAAAGTCCCAAAGGAAAGGAGGTAGAAGATGGAGACAAATTCATTTTTAATGGAGAATTCAAGCACAAGTTGTTTCGAATAAAGATCAATCAAATTCAGATGAAGGAAACAGTTGAAGAACAAGTCAGCACCACTGAGAGAGTGTTTCAGGACAGACAGTATCAGATTGACGCTGCTATTGTCAGAATAATGAAGATGAGAAAAACTCTTGGTCATAATCTTCTAGTTTCTGAATTATATAATCAGCTGAAATTTCCAGTAAAGCCTGGAGATTTGAAAAAGAGAATCGAATCTCTTATAGACAGAGACTATATGGAGAGAGACAAAGACAATCCAAATCAGTACCACTACGTGGCCTGACGTGTCGGTCAGCTATTTTCCTTCCATGAGACACTGGAATGTATCTTCAGAGCAGTGAAACGCTTTTGTGCTGTTTCCTGGGCTTTCTGGGATTGAGCCAGCACAGATACTTTGGCTTAGAAGGAAAGGAGATGATTCTTGGATAACCCTTCACAAGGCTTAAAGATTTGCAAATGTCATATGTATTTTTCCCCCTCCAGTTCTTCCTCTTGTTCTTTTAGGCATTTAAATTGTTTCCATTGCTCTGTGCAAAATGACTTCGGGATTGGACAAGAAGATATTGGTTAAATGAGGTTCCTTTGTAAGGTGTTGTTCTTGTGGCAAAAAAAAACCTGAAAGTTTGGTTTGTTTTGTGTGTGTGATCATGAATGCACAATTTAAAAGACCCTCTATGCTGCATTCTTTAGCTACAAAGATTACTTAGGTATTCCTGGAGATAAGCTATCTTAGTTGATGAACACTTAGATTAAAAACAAGAACCCTTAATTGGTGAACATTAGGAAGAAACAGTCAGTGCTAAAAACTGGCTAATCGATTATGCAACCTAAATACTGGCATCTGTTTCATTTTATTTTCAAAAAGTTTTAAACTTTGATGACTGATTTTTCGATAATGAGATTTCTCAGTGAGATCTCTGATGTGCCAAGAGGACATCGGGTCTGATGTGTTAGATGCAGTGAACCCATCAGCGTCTTTTATTTCCACTGAATTATTTGTGAATTTTCTGTTTAAGGTTGAGGGGATAGTGTGTTTGTGTTTACCATTCTAAGATTGAGTCTAGCAGTCCCTGTTTTTTGCATTGGGGTAACTGCTGTTTGATTTTTTTTTAATTGCAGTATTTGTATGATTGCTATAATAAAGTTTGGTTTTGTTTTTACAGTCATGTGCAGGGACAGTTGTTGTTCTCTGTGCTATAACCACTGTAAAATGTTTTATAGGAGACTTAAAGTCTTGATATTGTGAAGCAGAGGTTATTTTGTCGAAAGATTAAAAGGATTTCGTTGGCACCTGGTTTCATGTTGTGTATGTATGGGTGAGGATGAACAGCAGATGATGATGTTAGTATGGTAACTATAACAAAGATATTTTTATGATAACATTTAAAAGTACTTTATATTTTACATAATAGCATGTTTCATTTTAATTAAAAACTACCAAAGGAATTTTGATCATGGTATAAGTGTTTAAAGCAATATTTTCTGGAATATACCAAGTTTATATAATTTGATTTTGTGCTAAATTATTAAGAGTCTGCCTTTTTGAAACATGCGTGTTTAAAATATGACATGGGTTTCCATATGAAAGTCCTCACTCTTTAAGTATCATTTTATATTCGTAAATTTTAATTTGTGAATTCTATAATATGTAATCTATAAAAAGCCAAATAGATTTCTACTAATATTTTAAGTTCATTGTCTCTAGAGATTAATATTGTAATTTAATGTAGACTTACTCTGAATAAAATTAGTTTAATTGGCCTTAAAATTACATTGATAAAACTTTGTGGTATGTGAACTACACATTCCTCATAATTCTTAAGCAGC