Transcript asmbl_17887

Sequence
Transcript Sequence for observation asmbl_17887 of TGE0003927:
ATGTGCGCCGCTCAGCTGACGGCGGCCGCGGCGGCCGCGCAGGCGGCTGCGGCCCCGGGCTCCGTGTATGCCTACTCCGCGCGCCCGCTGGCGGGCGGGGAGCCCGTGAGCCTGGGCTCCCTGCGGGGCAAGGTGCTGCTCATTGAGAATGTGGCGTCGCTCTGAGGCACAACGGTCCGGGACTACACCCAGATGAACGAGCTGCAGCGGCGCCTCGGGCCCCGGGGTCTGGTGGTGCTCGGCTTCCCGTGCAACCAGTTCGGGCATCAGGAAAACACCAAAAACGAAGAGATCCTGAATTCTCTCAAGTACGTCCGACCTGGCGGCGGGTTCGAGCCCAACTTCACGCTCTTCGAGAAGTGCGACGTGAACGGCGCACAGGCGCACCCGCTCTTCACCTTCTTGAGGGAGGCTCTGCCGGCGCCCAGTGACGACACCACCGCGCTAATGACCGATCCCAAGTTCATCATCTGGTCTCCGGTATGCCGCAACGACATTGCCTGGAACTTCGAGAAGTTCCTGGTGGGCCGGGACGGCGTTCCTGTGCGCAGATACAGCCGCCGCTTCCCGACCATCGACATCGAGCCCGACATCGAAGCCCTGCTGTCCCAGGGGCCTAGCAGTGCCTAGGGCACCCCTGCTGCCTCTGCTTCTTGGCAGACACAGCGCTGCCCTCCGGGGGTTTTATCCATGATGGTGTTTCCGCTAAACCTGCAAGGAGGTACACCTGATGTCCAGGAAAATCCCCTGGGGTGGGCGCTGGGCCTGACCATCACAGCCTCTCCCTCCCACACCGCCACCCCTCTCAATAAAGTGTCCTGTCAGCAGAATCGTGT