Transcript asmbl_17521

Sequence
Transcript Sequence for observation asmbl_17521 of TGE0001765:
AGCGCATTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCCAGGACCCTGAAAATAAACAGCCGCTACTTTGCGAGCGTCTCTCCCTGGGTCTGCGTCATTTTCTCTGCCGCTTCGGGCCCGTTCAGACACCGAAGATCTGACTGTAGCCATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGCCCGACTGGTGGAGGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTGGTTTTACCTCAGATAGAGGTTTCCAGTTTGTTTCTTCATCTCTTCCAGACATCTGTTATCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTTCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGTTACAACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGTGATCATGCGGATGAGCAGAAGTGCTATTCTTGTGGAGAATTTGGACACATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCACCTTGCCCGGGAATGCACGATTGAGGCCACAGCTTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGACAGAGGCTACTCCCAGGCCAGTGAGCTTTACTTGCTGTGTAAAAGAAGGAAAGGGGTGGAAAAAAAATCGACTTTCTGCATTTAACTACAAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGCGCCACTGGTGAATAGGGATTGATGAATGGGAAGAGCTGAGTCAGACCAGTAAGCCCATTGTGGGTTTTTTGAATATGTTCCCATGTAGGAGGTAAAAACCAGTTCTGGAAGTGTCTGTGAGCTTCCATAAATAACTTTTAATTTTAGCATAATAATGGCCTTGGATTATCTGACCTCAGTAGCTGTTAAATAACATCTGTATCAGGCCATACATAGAACGTACAGTTGAGTGGGAGTAAACAAAATAAAAAGACAAACGTGTGTTAATATCTATGCGAGAAAAATCGGGATAAAAGCCTAAACAGGAACAACTTCCTAGCATTGATGCTGGATAAGCAGATGGTGATGGCAAAAGTTTAGAACACATTTTTTTCAAAGACTAAATCTAAAATGCAGAGTAAACATCTATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAGTGCATTTTCACAAAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTTTCATTTGCTGTAATCAGTTTTTTAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAATGTAATTTTAAACTATCCAATAAAGCTGGAGGAGGAAGGGGAGTTTGACTAAAGTTCTTTTTGTTTGTTTTAAATTTTCATTGATGTATATAGTGCAAAATGCCATATTAAAGAGGGGAATGTGGAGTACTG