Transcript asmbl_17518

Sequence
Transcript Sequence for observation asmbl_17518 of TGE0001880:
CAGTGACGGAAGTGGGAGCGGAGCCGGATTCTTGGCCATAAAGCCCGAGGCGGCGGTGGTGGCGGCGGCTTTGGAAGCTTGGAGAGCGACGAAGAGTCCGCTGAAACCGGAACTTGGACTTCTCTGCCCCTGTCCTCGCCTTGTAGTTCCTCTTCAGCGGGAGCCTTCGTGACGTGCCCGGCCCGAAGCCCCGTTCGGAGCGGCCGAGTTTGAAGGATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTTATCATCCTGGGAGATTCTGGAGTCGGTAAGACATCACTCATGAACCAGTATGTGAACAAGAAATTCAGTAATCAATACAAAGCCACAATAGGAGCAGACTTTCTGACAAAGGAGGTGATGGTGGATGACAGACTAGTTACAATGCAGATCTGGGACACGGCAGGACAGGAACGGTTCCAGTCTCTTGGTGTGGCCTTTTATAGAGGCGCAGACTGCTGTGTTCTGGTATTTGATGTGACTGCCCCGAACACATTCAAAACCCTTGATAGTTGGAGAGATGAGTTTCTCATCCAGGCCAGCCCTCGGGATCCTGAAAACTTTCCCTTTGTAGTGTTGGGAAATAAGATTGACCTCGAAAACAGACAAGTGGCCACGAAGCGAGCACAGGCCTGGTGCTACAGCAAAAACAACATTCCCTACTTTGAGACCAGTGCCAAGGAGGCCATCAACGTGGAGCAGGCCTTCCAGACGATTGCACGGAATGCACTTAAACAGGAAACAGAGGTGGAGCTGTACAATGAATTTCCTGAACCCATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCGGCAGAAAGCTGCAGTTGCTGAATGGGCAATGAGAGCAGAGCACAGAGTCCTTCACAAACCAAGAACACACTTAGGCCTTCCAACATAAATCCCTTCTCCTCTTCTAAACAAAGCATAAAGTGATTTCTCAGACGCAGTTGCCAAAAGAAACCCCACCAGACACACTCACCCCTCCATACAACACACATACAAATCTGATACAAGCAGACAGACTCCAGTCACAGGCCTGTGAGCTCTATCAGGGTCTGCCCACCTATCACATCAGCCCTCGTATAGCAGCATGACAGGCCAGCTGTAGAAATCGTTCTGGTGTTGGCATCGGAAGCTAATTCTTTTTGTCCACCAGAGAGGGAGAACTGTTTACAGTTAATCTATGTCGGATTGGTTATCTTAATTTTTTTTAATGGTCTTGTGGTCTTTTTACCCCATCCCCATTCCCCTCTTGTGAAGGCTACCACTTGGGAAGGCTGGTGCCCTATGCTTCATTACAGGCTCACACCCAGTCTGTTCAGGCTGAGTTTTGTATGTATCTGTTAATGCTTGTTACTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAATATATGCAACCAATTAAAAATGTATAAATTAGTGTAAGAAATTCTTGGATTATGTGTTTAAGTCCTGTAATGCAGGCATGTAAGATGGAGGGTTGAACACTGTCTGGATTGCAGAATGTTAGCAACTCAATTCAGAAATCCAGCTAGAGGCAGTATTCTGTACAGTAAACACAAGAATTATGTACACCTTTTATCAAAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCCAGGGGGAAAACTGTCTAGTTCCCTTCTGTATCTAAATTTTCCAAAAGGTTGATTTGCATAATACAGTGGTGAATGCAGTAGATAAATGGCTGTTGTTAAAATTCTTGTTTTTCCTTTTTTTCTTGCTCCACCCTTTGAAACTCCCCTATTAGATCAGCATCCTACTTATAAGAGGAAAAGGAAAATCCTAACAAATCTGTCCTAGTGATTTACCTTTGTTCTAGAAGGCGCTCTTTTCAGGGTTGTGGTATCCCTTAGGTTAGCAAACCTTTTTCTCCTTTTCCCCACCTCCCCAGTATTGCCCATTATTGATTAACCTGTTTCTTTGGTGTGGAATCCTGGCAGTTCTTCCCCCTTCCTAGGGTCTGCCCCTGCATTCTAGCTTGTTTAATGGAGCACTTCCCCCTTTCCCAAAGGTCTACATTCTAGGGTGTGGGCCAAGTTCTTTCTGTAAAGAGATGAACCTGATGCCAATAAAATGTAACAAGAGCAAAGATCATTGCCTTTGCCCTGTCTTTTTTTGTTCTTCCAGACCTTTGGCTCAGTAGACACCATGTTAGCTAATCATAACCAATGCTTTATCAAGCAAAATAGCCCTCCATAACTGCGCATGTTTGGTGCTTTGAGGCAGAAAGGCCTTCCCATGTCCAGTCCTGCAGTACTTGTCCTTACTTTGTTTCTATTTTTTATCTTAGTCACAGTATTGGAGAGGGGCGCACTCTGAATGGAGAACACATTATCTGTCCCCTTAGAGGAGCAGCCACAAACTACTGGTGACCTATGGACCCTGCACAGCCTCTGAGTGTAACTCAGCCTTAGTGTTGTGTTGCTTTTTAATTGGCGTAGTTCTGGATTTCACTGGAGAGGAAGATTTGGCAGCAG