Transcript asmbl_17223

Sequence
Transcript Sequence for observation asmbl_17223 of TGE0003894:
CGGGCGGGGCCGGAGCCGGGGGGCGCAGCTAGAGAGCCCCTGAGCGGCGGCGAGAGAGGATCGCACGGCCTCGAGGAGCCCAGGTCCGGCAGCCATGGCGGTGGAAGGAGGAATGAGATGTGTCAAGATCTTGCTCTACGTTTTTCTGGTGGCTTTTTGCGCCTGTGCAGTGGGACTGATCGTTGTGGGTATAGGGGCCCAGCTCGTCCTGAGTCAGACCATCAGCCAGGGGGCCACTCCTGGCTCCGTCTTGCCTGTGGTCATCATCGCAGTGGGTGCCTTCCTTTTCCTGGTGGCTATTGTGGGCTGCTGTGGGGCCTGCAAGGAGAACTACTGTCTTATGATCACGTTTGTTATCTTCCTGTCTCTTATTGTGCTGGTGGAGGTGGCTGCAGCCATTGCTGGCTATGTGTTTAGAGACAAGGTGATGTCAGAATTTAATAAGGACTTCCGGCAGCAGATGAAGAATTATCCAAAACAGAACCAGACGGCTTTGATCCTGGACAGGATGCAGGAAAATTTCAAGTGCTGCGGGGCAGCTAACTACACAGACTGGGAGACCATGCTTCTTGAGCCCAAAGGCCGAGTCCCTGACTCCTGCTGTATCAATGTCACTCAGGGCTGTGGGATTAATTACAATGTGAAGGAGATCTATACCGAGGGCTGTGTGGAGAAGATTGGGTTCTGGCTGAGGAGCAATGTGCTGGTGGTGGCTGCAGCAGCCCTGGGCATTGCCTTTGTGGAGGTCCTGGGAATTGTCTTTGCCTGCTGCCTTGTGAAGAGTATCCAAAGTGGCTATGAAGTGATGTAGGAGGTCTGGTCTCTTCAGCCCCTCTTCTAGGAGGGTGGGGTAATATACTCCATGTTTTTCAATTAAACGGATTATTTTTTCAGACCGAAG