Transcript asmbl_17187

Sequence
Transcript Sequence for observation asmbl_17187 of TGE0011691:
ACCACCGGCAGCTGGCCCGGCTCCGGGATGAGATCAACGAGAAGCAGAAGACCATCGATGAACTCAAAGACCTGAATCAGAAGCTCCAGTTAGAGCTAGAGAAGCTTCAGGCTGACTATGAGAAGCTGAAGAATGAAGAACATGAGAAGAGCACCAAACTCCAGGAGCTGACATTTCTGTACGAGCGACATGAGCAGTCCAAGCAGGACCTCAAGGGTCTGGAGGAGACAGTTGCCCGGGAACTCCAGACCCTCCACAACCTTCGCAAGCTGTTCGTTCAAGACGTCACGACTCGAGTCAAGAAAAGTGCAGAAATGGAGCCCGAGGACAGTGGGGGGATTCACTCCCAAAAGCAGAAGATTTCCTTTCTTGAGAACAACCTGGAACAGCTTACAAAGGTTCACAAACAGCTGGTACGTGACAATGCAGATCTGCGTTGTGAGCTTCCTAAATTGGAAAAACGACTTAGGGCTACGGCTGAGAGAGTTAAGGCCCTGGAGGGTGCACTGAAGGAAGCCAAGGAGGGCGCCATGAAGGACAAGCGCCGGTACCAGCAGGAGGTGGACCGCATCAAGGAGGCTGTTCGGTACAAGAGCTCTGGCAAGAGGGGCCATTCTGCTCAGATTGCCAAACCCGTCCGACCTGGCCACTACCCAGCATCTTCACCCACCAACCCCTATGGTACCCGAAGCCCTGAGTGCATCAGTTATACCAACAGCCTCTTCCAGAACTACCAGAATCTGTACCTGCAGCCTGCACCTAGCACCACCTCAGATATGTACTTTGCAAACTCCTGTACCGGCAGTGGGACCATGTCTTCTGGCAGCCCCTTGGCTTCCTACCAGAAGGCCAACATGGACAATGGAGTGATCTGCCATGCGGCTATGAGGCTGAGGACCAGGCCAAGCTTTTCCCTCTCCACCAAGAGACTGCGGCCAGCTAATCTCCCACTGGACTGCTGCATACCTGCACTTTCAGATCAATGAGCTCAGCCAGGTGCCTCCCCCGGTGATGCTGCTGCCAGATGACTTTAAGGCCAGCTCCAAGATCAAGGTTAACAATCACCTTTTCCACAGAGAAAATCTGCCCAGTCATTTCAAGTTCAAGGAGTATTGTCCGCAGGTCTTCAGAAACCTCCGTGATCGTTTTGGCATTGATGACCAGGATTACTTGGTGTCCCTTACCCGAAGTCCTCCAAGTGAAAGTGAAGGCAGTGATGGCCGCTTCCTTATCTCCTATGATCGGACTCTGGTCATCAAAGAAGTATCCAGTGAGGACATTGCTGACATGCATAGCAACCTCTCCAACTACCACCAGTACATTGTGAAGTGCCATGGCAGCACGCTGCTGCCCCAGTTCCTGGGGATGTACCGGGTTAGCGTGGACAATGAAGACAGCTACATGCTTGTGATGCGCAACATGTTTAGCCACCGTCTTCCTGTGCACAGGAAGTATGATCTCAAGGGCTCTCTAGTGTCCCGGGAAGCCAGCGATAAGGAAAAGGTTAAAGAATTGCCCACCCTTAAGGATATGGACTTTCTCAACAAGAACCAGAAAGTTTACATTGGGGAAGAGGAGAAGAAAGTATTTCTAGAGAAGCTAAAGAGAGATGTGGAGTTCCTAGTACAGCTGAAGATCATGGACTACAGCCTTCTGCTGGGCATCCATGACATCGTTCGGGGCTCTGAACCAGAGGAGGAGGGGCCTGTGCGGGAGGAGGAATCCTCCGAGGGGGATGGGGACTGTGG