Transcript asmbl_17186

Sequence
Transcript Sequence for observation asmbl_17186 of TGE0011690:
ACCACCGGCAGCTGGCCCGGCTCCGGGATGAGATCAACGAGAAGCAGAAGACCATCGATGAACTCAAAGACCTGAATCAGAAGCTCCAGTTAGAGCTAGAGAAGCTTCAGGCTGACTATGAGAAGCTGAAGAATGAAGAACATGAGAAGAGCACCAAACTCCAGGAGCTGACATTTCTGTACGAGCGACATGAGCAGTCCAAGCAGGACCTCAAGGGTCTGGAGGAGACAGTTGCCCGGGAACTCCAGACCCTCCACAACCTTCGCAAGCTGTTCGTTCAAGACGTCACGACTCGAGTCAAGAAAAGTGCAGAAATGGAGCCCGAGGACAGTGGGGGGATTCACTCCCAAAAGCAGAAGATTTCCTTTCTTGAGAACAACCTGGAACAGCTTACAAAGGTTCACAAACAGCTGGTACGTGACAATGCAGATCTGCGTTGTGAGCTTCCTAAATTGGAAAAACGACTTAGGGCTACGGCTGAGAGAGTTAAGGCCCTGGAGGGTGCACTGAAGGAAGCCAAGGAGGGCGCCATGAAGGACAAGCGCCGGTACCAGCAGGAGGTGGACCGCATCAAGGAGGCTGTTCGGTACAAGAGCTCTGGCAAGAGGGGCCATTCTGCTCAGATTGCCAAACCCGTCCGACCTGGCCACTACCCAGCATCTTCACCCACCAACCCCTATGGTACCCGAAGCCCTGAGTGCATCAGTTATACCAACAGCCTCTTCCAGAACTACCAGAATCTGTACCTGCAGCCTGCACCTAGCACCACCTCAGATATGTACTTTGCAAACTCCTGTACCGGCAGTGGGACCATGTCTTCTGGCAGCCCCTTGGCTTCCTACCAGAAGGCCAACATGGACAATGGAGTGATCTGCCATGCGGCTATGAGGCTGAGGACCAGGCCAAGCTTTTCCCTCTCCACCAAGAGACTGCGGCCAGCTAATCTCCCACTGGACTGCTGCATACCTGCACTTTCAGGTAGCTTCAGGCCGATTCCTCTGACCAGCCTCAGGTTGCCTCCTTTCTTGCCCTCAGCCTATTTATTTCTCCCACTTTTATTTATCATCTCAAACCTTTTACTACTTAGCTGTCCCCCAACTCCTGTTTTCTCCGTCCTAGGAGCTACAGTCACACTGCCCCAGGTCCTCTTATCTCCCCTCCCCCCTTATGCTTTCCCTGCATCCCTAGTAGTAGCCACAGTACTGCCTTTCTGCCACTAGGGGTCACTGCCACATGTCAAAAGAAGTGAAAAAAGGCAAATGGATCCAGAGCCACCCTTAGGTCACAGGATGCATTAGATATTAGGAGACCTTGGGAGATCATCTCAATCCTCCCTCTGCCTCCACTATAAAATAATTTTGGATGGATAGGTATTTTCTAAGACATCTCCAGTAAAGGAGATGTTTGATTTATTTCTGTACCT