Transcript asmbl_17179

Sequence
Transcript Sequence for observation asmbl_17179 of TGE0011689:
CCCAGCCCCACGCCGGCGACCACCATGGCGGAGACCAACAACGAATGTAGCATCAAGGTGCTCTGCCGATTTCGGCCCCTGAACCAGGCCGAGATTCTGCGGGGGGACAAATTCATCCCCATTTTTCAAGGGGACGACAGCGTCGTTATTGGGGGAAAGCCATATGTCTTTGACCGTGTATTTCCCCCAAACACGACTCAGGAGCAAGTTTATCATGCATGTGCCATGCAGATTGTCAAAGATGTCCTTGCTGGCTACAATGGCACCATATTTGCTTATGGACAGACATCCTCAGGAAAAACACATACTATGGAGGGAAAGCTGCATGACCCTCAGCTGATGGGAATTATTCCTCGAATTGCCCGAGACATCTTCAACCACATCTACTCCATGGATGAGAATCTTGAGTTCCACATCAAGGTTTCTTACTTTGAGATTTACCTGGACAAAATTCGTGACCTTCTGGATGTGACCAAGACAAATCTGTCTGTGCATGAGGACAAGAACCGGGTGCCATTTGTCAAGGGTTGTACTGAACGCTTTGTGTCCAGCCCAGAGGAGATTTTAGATGTGATTGACGAGGGGAAATCAAACCGTCATGTGGCTGTCACCAACATGAATGAGCACAGCTCTCGCAGCCACAGCATCTTCCTCATCAACATCAAGCAGGAGAACATGGAGACTGAGCAGAAGCTCAGTGGGAAGCTGTATCTGGTGGACCTGGCTGGGAGCGAGAAGGTCAGCAAGACTGGAGCAGAGGGAGCCGTCCTGGATGAGGCAAAGAATATCAACA