Transcript asmbl_16205

Sequence
Transcript Sequence for observation asmbl_16205 of TGE0011645:
AGGTGAGGCCCTCCGGGACCTGGTGGTGAGGAAGCCCGAGCAGCGGGACCGGAGAACGGACGGCGCCGGGGTGAAGCTCAGAGTGAAGCCTGACTGGAGCCCCGGCAGCAGGCCCCCCGGGATGCTCTGGGCATGGCCTCTAGAGCCCCACAGCAGAGCAGCCAGATGGCAGAGGAGACCCCTGGCTTCCTGGATGCCCTCCTCCGCGACTTCCCAGCCCCGCTGAACCTGGAGAGCCCTTTGCCGTGGAAGGTCCCAGGGACAGTGCTGAGCCAAGAGGAAGTAGAGGGCGAGCTGATCGAGCTGGCGATGGGCTTCCTGAGCAGCAGCAGTTTCCCAGCTGCTACAGA