Transcript asmbl_16204

Sequence
Transcript Sequence for observation asmbl_16204 of TGE0011644:
AGGTGAGGCCCTCCGGGACCTGGTGGTGAGGAAGCCCGAGCAGCGGGACCGGAGAACGGACGGCGCCGGGGTGAAGCTCAGAGTGAAGCCTGACTGGAGCCCCGGCAGCAGGCCCCCCGGGATGCTCTGGGCATGGCCTCTAGAGCCCCACAGCAGAGCAGCCAGATGGCAGAGGAGACCCCTGGCTTCCTGGATGCCCTCCTCCGCGACTTCCCAGCCCCGCTGAACCTGGAGAGCCCTTTGCCGTGGAAGGTCCCAGGGACAGTGCTGAGCCAAGAGGAAGTAGAGGGCGAGCTGATCGAGCTGGCGATGGGCTTCCTGAGCAGCAGGAACGCTCTGCCACCACTTGCTTCATCTCTGGCTCATGAAGCAGTTTCCCAGCTGCTACAGACAGACCTTTCTGAGTTCAGGAAGCTGCCCAGGCAGGAGGTGGAGGACAACGAGGAAGAGGAGGAGAAGACCCCCGTGACCCTGCTGGATGCCAAGGGCCTGGCGCGGAGCTTCTTTAACCAGCTCTGGGAAGTGTGCAGCCAGTGGCAGAAGCAGGTGCCCTTGGCTGCCCGAGTGCCACAGCGGCAGTGGCTGGTCTCCATCCACGCCATCCGGAACACTCGCCGCAAGATGGAGGACCGGCACGTGTGCCTTCCCACCTTCAACCAGCTCTTCGGCTTGTCCGACCCTGTGGACCGCGCCTACTTTGCCGTGTTTGACGGTCATGGAGGTGTGGACGCTGCGAGGTATGCCGCTGTGCACGTACACGCCAACACTGCCCGCCAGCCAGAGCTGCCCACAGACCCCGCGGGAGCCCTCAGAGAAGCCTTCCGGCGCACCGATGAGATGTTCCTCTGGAAAGCCAAGCGAGAGCGGCTGCAGAGTGGCAGCACAGGTGTGTGCGCACTCATCGCGGGAAAGACGCTGCACATCGCCTGGCTCGGGGACTCCCAGGTCATCTTGGTGCAGCAGGGGCAGGTGGTGAAGCTGATGGAGCCTCACAAACCTGAGCGACAGGACGAGAAGGAGCGCATTGAAGCGCTGGGTGGCTTCGTGTCTCATATGGACTGCTGGAGAGTCAACGGGACCCTAGCTGTCTCCAGAGCCATAGGGGATGTCTTCCAGAAGCCCTACGTGTCTGGGGAGGCAGACTCAGCCTCCCGGGAGCTGACCGGCTCCGAGGACTACCTGCTGCTGGCCTGTGATGGTTTCTTCGATGTTGTCCCCCACCAGGAGGTGGCTGGCCTTGTCCAGAGCCACCTGGTCAGGCAGCAGGGCAGTGGGCTGCATGTCGCCGAGTTGCTGGTGGCTGCAGCCCGGGAGCGAGGCTCCCATGACAACATCACAGTCATGGTAGTCTTCCTCAGGGATCCCCAACAGCTGCTGGAGAGTGGGGCCCAGGGAGCAGGGGACTCCCCAGTAGATGG