Transcript asmbl_31057

Sequence
Transcript Sequence for observation asmbl_31057 of TGE0001320:
GGTGCTGGAGGAGGGGGCCGGCGGCGAGGGACTCCAGGAGGACGCGTCCAACTTCGAGACCGGCGGGGGCCGGCTCCGCTCTTCCAACCCCTCCATGTGTGAAGAGGGCGGACGACGCAGCGGGGGAAGAAAAATAAGCTAGTCTAGGACAAGTGTCCAGGCGACGTGGAACCCAGGTGTCTTTTATGAATAATCAAAAGCAGCAAAAGCCAACGCTATCAGGCCAGCGTTTTAAAACTAGAAAAAGAGATGAAAAAGAGAGGTTTGACCCTACTCAGTTTCAAGACTGTATTATTCAAGGCTTAACTGAAACCGGTACTGATTTGGAAGCAGTAGCTAAGTTTCTTGATGCTTCTGGAGCAAAACTTGATTACCGTCGATATGCAGAAACACTCTTTGACATTCTGGTGGCTGGTGGAATGCTGGCCCCAGGTGGTACACTGGCAGATGACATGATGCGTACAGATGTCTGCGTGTTTGCAGCCCAAGAAGATCTAGAGACCATGCAAGCATTTGCTCAGGTTTTTAACAAGTTAATCAGGCGCTACAAATACCTGGAGAAAGGTTTTGAAGATGAAGTAAAAAAGCTGCTGCTGTTCTTGAAGGGTTTTTCAGAGTCGGAGAGGAACAAGCTAGCTATGTTGACTGGTGTTCTTCTGGCTAATGGAACACTTAATGCATCCATTCTTAATAGCCTTTATAATGAAAATTTGGTTAAAGAAGGAGTTTCAGCAGCTTTTGCTGTGAAGCTCTTTAAATCATGGATAAATGAAAAAGATATCAATGCAGTAGCTGCAAGTCTTCGGAAAGTCAGCATGGATAACAGACTGATGGAACTCTTTCCTGCCAATAAGCAAAGTGTTGAACACTTCACAAAATATTTTACTGAGGCAGGCTTGAAAGAGCTTTCAGAATATGTTCGGAATCAGCAAACCATCGGAGCTCGTAAGGAGCTCCAGAAAGAACTTCAAGAACAGATGTCCCGTGGTGATCCATTTAAGGATATAATTTTATATGTCAAGGAGGAGATGAAAAAAAACAACATCCCAGAGCCAGTTGTCATCGGAATAGTCTGGTCAAGTGTAATGAGCACTGTGGAATGGAACAAAAAAGAGGAGCTTGTAGCAGAGCAAGCCATCAAGCACTTGAAGCAATACAGCCCTCTACTTGCTGCCTTTACTACTCAAGGTCAGTCTGAGCTGACTCTGTTACTGAAGATTCAGGAGTATTGCTATGACAACATTCATTTCATGAAAGCCTTCCAGAAAATAGTGGTGCTTTTTTATAAAGCTGAAGTCCTGAGCGAGGAGCCCATTTTGAAGTGGTATAAAGATGCACATGTTGCAAAGGGGAAGAGTGTTTTCCTTGAGCAAATGAAAAAGTTTGTAGAATGGCTCAAAAATGCTGAAGAAGAATCTGAATCTGAAGCTGAAGAAGGTGACTGAATTTTGAAACTACACCCTCAGTAAAGCAAACAGGAGTTGTAGATAAAATGTCATGTCTCATGTGTCCTGGTTCTTACATCTTCCTACCTCCCTGTATCAAGCATGATATAAGGGCTTTCATGGCAAATTTTATTTTAACTGTTTCTATGGTTGCTGGAAATGTTGGGTTTAGTTTCTAAAACCATGTTTTAAGTAGCTACAGGAGCTATAGATTTGAATCTAATGTTGCATTAGTCTTTTCAGTTATCTTCTACCTCCTGTATTTTCTACTGTAATAATGTAATTTAAGGCCTTCCACAATGAACAGTTCACTTTATTCCCTGGGTTTTCTATAAACAGTTTTAAGGATATGATTTGGTTAAAAAATAATTTGTTATAAAAATTCTGTTTGCAAATTAAACTGGAAAAGTATCCAGAGTCTCAAAAGGCAATGATTTGTGAGATAATATGGCATGCCCGGAGCCCTGCTCATCAATGAAAAACCCATATGTAATAATCGAATTCATTTAACATGAATCTTGAGTACGTGGACCATTGCTTGCATG