Transcript asmbl_13230

Sequence
Transcript Sequence for observation asmbl_13230 of TGE0000130:
AAAACGGTGAATGGAGAGCGAGTTGTGGGGGGGAAAAAGGGAGGACAGGGGGCGCGGAGTCAGAGTGGCGCAGCAAGTGGCCGCAGGTGGCGACGGTGGCGGGGGGTGGGGTGTGAGGTAATCCAGGGGTCGCGGAAGAGGAGGCTGAGAGGGTCAAAAGAAAACTAAAGCTGCAGTCCGGCCTACTGTTCCGGGGGCCGCGGAGCCCCCACCCGGGGAGATGGACCTCAACCGGATCATCCAGGCGCTGAAGGGCACCATCGACCCGAAGTTGCGGATTGCAGCCGAGAACGAGCTCAACCAGTCCTACAAGATTATCAATTTTGCCCCCAGTTTACTTCGGATTATAGTCTCTGACCATGTGGAATTCCCAGTACGACAGGCAGCTGCCATTTACCTGAAGAACATGGTGACACAATACTGGCCAGATCGAGAACCTCCACCAGGAGAAGCAATATTTCCATTCAACATTCACGAAAACGATCGCCAGCAAATACGTGATAACATTGTGGAAGGAATAATTCGGTCTCCAGATTTAGTGAGAGTCCAATTAACAATGTGTCTCCGTGCCATCATAAAACATGATTTTCCTGGTCACTGGCCAGGAGTGGTCGACAAGATAGACTATTACTTGCAATCACAGAGCAGTGCAAGCTGGCTTGGCAGTTTATTATGCCTGTATCAACTGGTGAAGACATATGAATATAAGAAAGCAGAAGAGAGAGAACCTCTTATAATAGCAATGCAGATATTCCTGCCTCGTATTCAGCAACAAATTGTTCAGCTCCTTCCTGATTCCTCCTATTATTCTGTATTACTGCAGAAACAAATTCTGAAAATCTTTTATGCACTTGTTCAGTATGCATTGCCTCTTCAGCTAGTGAATAACCAAACCATGACAACATGGATGGAGATCTTCCGAACTATTATCGACAGGACCGTTCCTCCTGAGACTCTGCACATTGATGAGGATGATAGACCAGAACTGGTATGGTGGAAGTGTAAGAAGTGGGCACTGCATATTGTAGCTCGGCTCTTTGAACGATATGGAAGCCCAGGAAATGTCACAAAAGAATACTTTGAATTTTCTGAATTCTTTTTGAAAACCTATGCAGTGGGCATTCAGCAGGTGCTACTAAAAATTTTAGATCAATATAGACAGAAAGAATATGTAGCTCCCCGTGTTCTTCAGCAAGCATTCAACTATCTCAACCAAGGGGTGGTTCATTCTATAACCTGGAAGCAGATGAAGCCACACATACAGAATATCTCTGAAGATGTGATTTTTTCTGTGATGTGTTATAAAGATGAGGATGAAGAGCTGTGGCAAGAAGATCCATATGAGTATATAAGGATGAAATTTGATATTTTTGAAGATTATGCTTCTCCCACCACAGCAGCCCAGACTCTCTTATATACTGCTGCAAAGAAAAGAAAAGAGGTGTTGCCAAAAATGATGGCATTCTGTTATCAAATCCTGACAGACCCGAACTTTGACCCTAGGAAGAAAGATGGAGCCCTGCATGTGATTGGTTCCCTAGCTGAGATTTTACTGAAGAAGAGTTTATTCAAGGACCAAATGGAGCTGTTTCTACAAAATCATGTATTTCCATTATTATTGTCTAACCTGGGATATCTTCGAGCTAGATCTTGCTGGGTACTTCATGCATTTAGTTCTTTGAAGTTCCATAATGAGCTCAATCTAAGAAATGCCGTTGAATTAGCGAAGAAGAGCCTGATTGAAGATAAAGAGATGCCTGTCAAAGTTGAAGCTGCCCTTGCTCTTCAGTCTTTAATTTCTAACCAGATACAAGCTAAGGAATATATGAAGCCACATGTGAGGCCTATTATGCAGGAACTGTTGCACATTGTTAGAGAGACAGAAAATGATGATGTTACTAATGTCATCCAGAAGATGATATGTGAATACAGTCAAGAGGTAGCCTCAATTGCTGTTGATATGACCCAACACTTGGCTGAGATATTTGGCAAAGTTCTTCAAAGTGATGAATATGAAGAAGTTGAAGACAAAACAGTAATGGCTATGGGAATTTTACATACCATTGATACTATCTTAACAGTTGTAGAAGATCATAAAGAGATTACCCAGCAGTTAGAGAATATCTGTCTACGGATCATTGATCTTGTTCTGCAGAAACATGTAATTGAATTCTATGAAGAAATTCTTTCCCTGGCATACAGTTTAACCTGCCACAGTATTTCCCCTCAAATGTGGCAGCTTCTAGGTATACTATATGAAGTGTTTCAGCAGGATTGCTTTGAATACTTTACAGACATGATGCCTCTCCTGCATAATTATGTGACAATAGATACAGATACCTTACTATCAAATGCAAAACATTTAGAAATTCTTTTTACAATGTGTAGGAAGGTACTATGTGGAGATGCAGGAGAAGATGCAGAGTGTCA