Transcript asmbl_31056

Sequence
Transcript Sequence for observation asmbl_31056 of TGE0001320:
GGGCTTCGACTTCCGGTGCTGGAGGAGGGGGCCGGCGGCGAGGGACTCCAGGAGGACGCGTCCAACTTCGAGACCGGCGGGGGCCGGCTCCGCTCTTCCAACCCCTCCATGTGTGAAGAGGGCGGACGACGCAGCGGGGGAAGAAAAATAAGCTAGTCTAGGACAAGTGTCCAGGCGACGTGGAACCCAGTAAGGGAATAAAGAAGACTGGAAACGTCTCTCCCCTCCCCTATCCCAGTCCCTCACCCTAATCCGCGCGCAATAGAAAAGGCGGAAGCGCCTGTCCACGATCAGGGCGGGGCAAGGGGAAGAAATCTCGCGATAGGAGAGCGGTCCGGGCGGGGGTGGCACCTCTCCCTCCTCCTGGCGTTAGTTCCGGTCGCAGAGGAGACACCGCCGCAGTTGCCGGTACATCGGGGATTTCTGGCTCTTTCCTCTTCGCCTTAAATTCGGGTGTCTTTTATGAATAATCAAAAGCAGCAAAAGCCAACGCTATCAGGCCAGCGTTTTAAAACTAGAAAAAGAGATGAAAAAGAGAGGTTTGACCCTACTCAGTTTCAAGACTGTATTATTCAAGGCTTAACTGAAACCGGTACTGATTTGGAAGCAGTAGCTAAGTTTCTTGATGCTTCTGGAGCAAAACTTGATTACCGTCGATATGCAGAAACACTCTTTGACATTCTGGTGGCTGGTGGAATGCTGGCCCCAGGTGGTACACTGGCAGATGACATGATGCGTACAGATGTCTGCGTGTTTGCAGCCCAAGAAGATCTAGAGACCATGCAAGCATTTGCTCAGGTTTTTAACAAGTTAATCAGGCGCTACAAATACCTGGAGAAAGGTTTTGAAGATGAAGTAAAAAAGCTGCTGCTGTTCTTGAAGGGTTTTTCAGAGTCGGAGAGGAACAAGCTAGCTATGTTGACTGGTGTTCTTCTGGCTAATGGAACACTTAATGCATCCATTCTTAATAGCCTTTATAATGAAAATTTGGTTAAAGAAGGAGTTTCAGCAGCTTTTGCTGTGAAGCTCTTTAAATCATGGATAAATGAAAAAGATATCAATGCAGTAGCTGCAAGTCTTCGGAAAGTCAGCATGGATAACAGACTGATGGAACTCTTTCCTGCCAATAAGCAAAGTGTTGAACACTTCACAAAATATTTTACTGAGGCAGGCTTGAAAGAGCTTTCAGAATATGTTCGGAATCAGCAAACCATCGGAGCTCGTAAGGAGCTCCAGAAAGAACTTCAAGAACAGATGTCCCGTGGTGATCCATTTAAGGATATAATTTTATATGTCAAGGAGGAGATGAAAAAAAACAACATCCCAGAGCCAGTTGTCATCGGAATAGTCTGGTCAAGTGTAATGAGCACTGTGGAATGGAACAAAAAAGAGGAGCTTGTAGCAGAGCAAGCCATCAAGCACTTGAAGCAATACAGCCCTCTACTTGCTGCCTTTACTACTCAAGGTCAGTCTGAGCTGACTCTGTTACTGAAGATTCAGGAGTATTGCTATGACAACATTCATTTCATGAAAGCCTTCCAGAAAATAGTGGTGCTTTTTTATAAAGCTGAAGTCCTGAGCGAGGAGCCCATTTTGAAGTGGTATAAAGATGCACATGTTGCAAAGGGGAAGAGTGTTTTCCTTGAGCAAATGAAAAAGTTTGTAGAATGGCTCAAAAATGCTGAAGAAGAATCTGAATCTGAAGCTGAAGAAGGTGACTGAATTTTGAAACTACACCCTCAGTAAAGCAAACAGGAGTTGTAGATAAAATGTCATGTCTCATGTGTCCTGGTTCTTACATCTTCCTACCTCCCTGTATCAAGCATGATATAAGGGCTTTCATGGCAAATTTTATTTTAACTGTTTCTATGGTTGCTGGAAATGTTGGGTTTAGTTTCTAAAACCATGTTTTAAGTAGCTACAGGAGCTATAGATTTGAATCTAATGTTGCATTAGTCTTTTCAGTTATCTTCTACCTCCTGTATTTTCTACTGTAATAATGTAATTTAAGGCCTTCCACAATGAACAGTTCACTTTATTCCCTGGGTTTTCTATAAACAGTTTTAAGGATATGATTTGGTTAAAAAATAATTTGTTATAAAAATTCTGTTTGCAAATTAAACTGGAAAAGTATCCAGAGTCTCAAAAGGCAATGATTTGTGAGATAATATGGCATGCCCGGAGCCCTGCTCATCAATGAAAAACCCATATGTAATAATCGAATTCATTTAACATGAATCTTGAGTACGTGGACCATTGCTTGCATGTTAACTTTTTGTTTTGTTTTGTTTTGTTTT