Transcript asmbl_31049

Sequence
Transcript Sequence for observation asmbl_31049 of TGE0001319:
GGAAGGCGGGCGGGTCGGCGGGCGGGGGCAGCCTGCGAGGGGCGGGAGTGTCCCTGCGTGGGGCGGCCGAGCCGGAGTTGTGTCAGTGAAGGAATCCAGTCCGGGGGCCGAGCTGGCTGCGCCCTCCGCTGCAAGCGCCGGCAGCGCGGGGCGAGCTCCGGACGGCGCGCGGCCCAGGCAGCGGCTCCCGCTCGGCCCGCCCTCCGAGCCGCAGGGGCCGCCACCGCCGCGGCGCCTCCCCTGGCGACCGCGCCCCCGGGCCCCGGCTCCGGCCCGGGACGGAGGAGCCGGCGCTCGACACAGAGAGCTCTTCAGAAACCAGGCTGCTTTCAGGAACATTGCTGTGGATTCCCAGGGCCTATTCCACTAGAAGCAAGATGGCTGAACTCAATACTCATGTGAATGTCAAGGAAAAGATCTATGCAGTTAGATCAGTTGTTCCCAACAAAAGCAATAATGAAATAGTCCTGGTGCTCCAACAGTTTGATTTTAATGTGGATAAAGCCGTGCAAGCCTTTGTGGATGGCAGTGCAATTCAAGTTCTAAAAGAATGGAATATGACAGGAAAAAAGAAGAACAATAAAAGAAAAAGAAGCAAGTCCAAGCAGCATCAAGGCAACAAAGATGCTAAAGACAAGGTGGAGAGGCCTGAGGCAGGGCCCCTGCAGCCGCAGCCACCACAGATTCAAAACGGCCCCATGAATGGCTGCGAGAAGGACAGCTCGTCCACAGATTCTGCTAACGAAAAACCAGCCCTTATCCCTCGTGAGAAAAAGATCTCGATACTTGAGGAACCTTCAAAGGCACTTCGTGGGGTCACAGGCCCAAATATTGAGAAATCAGTGAAGGATTTGCAACGCTGCACCGTTTCTCTAACTAGATATCGCGTCATGATTAAGGAAGAAGTGGATAGTTCCGTGAAGAAGATCAAAGCTGCCTTTGCTGAATTACACAACTGCATCATTGACAAAGAAGTTTCATTAATGGCAGAAATGGATAAAGTTAAAGAAGAAGCCATGGAAATCCTGACTGCTCGTCAGAAGAAAGCAGAAGAACTAAAGAGACTCACTGACCTTGCCAGTCAGATGGCAGAGATGCAGCTGGCCGAACTCAGGGCAGAAATTAAGCACTTTGTCAGCGAGCGTAAATATGACGAGGAGCTCGGGAAAGCTGCCCGGTTTTCCTGTGACATCGAACAGCTGAAGGCCCAAATCATGCTCTGCGGAGAAATTACACATCCAAAGAACAACTATTCCTCAAGAACTCCCTGCAGCTCCCTGCTGCCTCTGCTGAATGCGCACGCAGCAACCTCTGGGAAACAGAGTAACTTTTCCCGAAAATCATCCACTCACAATAAGCCCTCTGAAGGCAAAGCGGCAAACCCCAAAATGGTGAGCAGTCTCCCCAGCACCGCCGACCCCTCTCACCAGACCATGCCGGCCAACAAGCAGAATGGATCTTCTAACCAAAGACGGAGATTTAATCCACAGTATCATAACAACAGGCTAAATGGGCCTGCCAAGTCGCAGGGCAGTGGGAATGAAGCCGAGCCACTGGGAAAGGGCAACAGCCGCCACGAACACAGAAGACAGCCGCACAACGGCTTCCGGCCCAAAAACAAAGGCGGTGCCAAAAATCAAGAGGCTTCCTTGGGGATGAAGACCCCCGAGGCCCCGGCCCATTCTGAAAAGCCCCGGCGAAGGCAGCACGCTGCAGACACCTCGGAGGCCAGGCCCTTCCGGGGTAGTGTCGGTAGGGTTTCACAGTGCAATCTCTGCCCCACGAGAATAGAAGTTTCCACAGATGCAGCAGTTCTCTCAGTCCCGGCTGTGACGTTGGTGGCCTGAGCTAGGAGGAAAAAGAGCAGTTTTCACTCAGTTTTGGTTCCCTGCCCGAGGTGCTGACCCAATTCGCTGCCAAAAGAGTGTCAATCAGAATATACAAATCCCGTATGGTTGTGTCATCCTCTCTTAATCATTTTTACTAATTCTAATAATCAGCTCTAGCTTGCTTCATAATTTTCATGGCTTTGCTTGATCTGTTGATGCTTTCTCTCATCAAGACTTTGCAGCATTTTAGCCAGGCAGTATTTACTCATTATTAGGAAAATCAAGATGTGGCTGAAGATCAGAGGCTCAGTTAGCAACCTGTGTTGTAGCAGTGATGTCAGTCCATTGATTGTCTTTAGAGAGTTAATGTTACAAAAAAGAATTCTTAATAATCAGACAAACATGATCTGCTGAGGACACATGCGCTTTTGTAGAATTTAACATCTGGTGTTTTTCTGAAAAAATATATATACATATATTGCTTTATTTGAAACAAATTAAAATATGCTGCA