Transcript asmbl_31047

Sequence
Transcript Sequence for observation asmbl_31047 of TGE0001319:
TCTCTTGCAACACGTGCGGATTGTGACAAAATCTTTCATTAACAAGGGGAGTTTCGGTGAAGTGGAGGTTTGGGGAAAGGCGAGGAAGTCGGTCTGGAGCAAGCAAGCAAAGTGCGGAAGCTGTACTGGGATTCTTCTAGAAAGTGGGGTGGGAAAGGAGCTAGGGAGGGCGTGTGGAGGGACGAGATCTGTGTCAGAACGTGCGTGTGAGCGGATACAAAACCCGAGAGAGGCGTGAGCAGCGCTGTGTTTGCGAGCGGGAGCGAGGGGCGCCGGCTGGGGTGTGTGCTCCTGAGCTCTTCAGAAACCAGGCTGCTTTCAGGAACATTGCTGTGGATTCCCAGGGCCTATTCCACTAGAAGCAAGATGGCTGAACTCAATACTCATGTGAATGTCAAGGAAAAGATCTATGCAGTTAGATCAGTTGTTCCCAACAAAAGCAATAATGAAATAGTCCTGGTGCTCCAACAGTTTGATTTTAATGTGGATAAAGCCGTGCAAGCCTTTGTGGATGGCAGTGCAATTCAAGTTCTAAAAGAATGGAATATGACAGGAAAAAAGAAGAACAATAAAAGAAAAAGAAGCAAGTCCAAGCAGCATCAAGGCAACAAAGATGCTAAAGACAAGGTGGAGAGGCCTGAGGCAGGGCCCCTGCAGCCGCAGCCACCACAGATTCAAAACGGCCCCATGAATGGCTGCGAGAAGGACAGCTCGTCCACAGATTCTGCTAACGAAAAACCAGCCCTTATCCCTCGTGAGAAAAAGATCTCGATACTTGAGGAACCTTCAAAGGCACTTCGTGGGGTCACAGGCCCAAATATTGAGAAATCAGTGAAGGATTTGCAACGCTGCACCGTTTCTCTAACTAGATATCGCGTCATGATTAAGGAAGAAGTGGATAGTTCCGTGAAGAAGATCAAAGCTGCCTTTGCTGAATTACACAACTGCATCATTGACAAAGAAGTTTCATTAATGGCAGAAATGGATAAAGTTAAAGAAGAAGCCATGGAAATCCTGACTGCTCGTCAGAAGAAAGCAGAAGAACTAAAGAGACTCACTGACCTTGCCAGTCAGATGGCAGAGATGCAGCTGGCCGAACTCAGGGCAGAAATTAAGCACTTTGTCAGCGAGCGTAAATATGACGAGGAGCTCGGGAAAGCTGCCCGGTTTTCCTGTGACATCGAACAGCTGAAGGCCCAAATCATGCTCTGCGGAGAAATTACACATCCAAAGAACAACTATTCCTCAAGAACTCCCTGCAGCTCCCTGCTGCCTCTGCTGAATGCGCACGCAGCAACCTCTGGGAAACAGAGTAACTTTTCCCGAAAATCATCCACTCACAATAAGCCCTCTGAAGGCAAAGCGGCAAACCCCAAAATGGTGAGCAGTCTCCCCAGCACCGCCGACCCCTCTCACCAGACCATGCCGGCCAACAAGCAGAATGGATCTTCTAACCAAAGACGGAGATTTAATCCACAGTATCATAACAACAGGCTAAATGGGCCTGCCAAGTCGCAGGGCAGTGGGAATGAAGCCGAGCCACTGGGAAAGGGCAACAGCCGCCACGAACACAGAAGACAGCCGCACAACGGCTTCCGGCCCAAAAACAAAGGCGGTGCCAAAAATCAAGAGGCTTCCTTGGGGATGAAGACCCCCGAGGCCCCGGCCCATTCTGAAAAGCCCCGGCGAAGGCAGCACGCTGCAGACACCTCGGAGGCCAGGCCCTTCCGGGGTAGTGTCGGTAGGGTTTCACAGTGCAATCTCTGCCCCACGAGAATAGAAGTTTCCACAGATGCAGCAGTTCTCTCAGTCCCGGCTGTGACGTTGGTGGCCTGAGCTAGGAGGAAAAAGAGCAGTTTTCACTCAGTTTTGGTTCCCTGCCCGAGGTGCTGACCCAATTCGCTGCCAAAAGAGTGTCAATCAGAATATACAAATCCCGTATGGTTGTGTCATCCTCTCTTAATCATTTTTACTAATTCTAATAATCAGCTCTAGCTTGCTTCATAATTTTCATGGCTTTGCTTGATCTGTTGATGCTTTCTCTCATCAAGACTTTGCAGCATTTTAGCCAGGCAGTATTTACTCATTATTAGGAAAATCAAGATGTGGCTGAAGATCAGAGGCTCAGTTAGCAACCTGTGTTGTAGCAGTGATGTCAGTCCATTGATTGTCTTTAGAGAGTTAATGTTACAAAAAAGAATTCTTAATAATCAGACAAACATGATCTGCTGAGGACACATGCGCTTTTGTAGAATTTAACATCTGGTGTTTTTCTGAAAAAATATATATACATATATTGCTTTATTTGAAACAAATTAAAATATGCTGCA