Transcript asmbl_14882

Sequence
Transcript Sequence for observation asmbl_14882 of TGE0003765:
CAGGAGGCTGTGCGCTGCCCTTGCTGCCTTTGGGTTCTTGAGAGCGAGCGCGTGAACGGCTCTCTGCAGTCTAGTCATGGCGCTTCACGTCCCCAAGGCCCCGGGCTTTGCCCAGATGCTCAAGGAGGGAGCGAAGCATTTTTCAGGATTAGAAGAAGCAGTGTACAGGAACATACAAGCTTGCAAGGAGCTTGCCCAAACCACTCGTACAGCGTATGGACCAAATGGAATGAACAAAATGGTTATCAACCACCTGGAGAAGTTGTTTGTGACAAATGATGCAGCGACTATTTTAAGAGAGCTGGAAGTACAGCATCCTGCTGCAAAAATGATCGTAATGGCCTCTCACATGCAAGAGCAAGAGGTTGGAGATGGCACCAACTTTGTTCTGGTGTTTGCCGGAGCTCTTCTGGAATTAGCGGAAGAGCTTCTTAGAATTGGCCTGTCAGTTTCGGAGGTCATAGAAGGTTACGAAATAGCCTGCAAAAAAGCCCATGAGATTCTTCCTGATTTGGTATGCTGTTCTGCAAAAAATCTTCGAGATATTGATGAAGTGTCATCTCTACTTCATACCTCCATAATGAGTAAACAGTATGGTAATGAAGTCTTTCTGGCCAAGCTTATTGCTCAAGCATGTGTATCTATTTTTCCTGATTCTGGCCATTTCAATGTTGATAACATCAGAGTTTGTAAGATTTTGGGCTCTGGTATCTCTTCCTCTTCAGTATTACATGGCATGGTTTTTAAGAAGGAAACTGAAGGTGATGTAACATCTGTCAAAGATGCAAAAATAGCAGTGTACTCCTGTCCTTTTGATGGCATGATAACAGAAACTAAGGGAACGGTATTGATAAAGACTGCTGAAGAGTTGATGAATTTTAGTAAGGGAGAAGAAAATCTTATGGATGCACAAGTCAAAGCTATTGCTGATACCGGTGCAAATGTCGTCGTAACAGGTGGTAAAGTGGCAGACATGGCTCTTCATTATGCAAACAAATACAATATCATGTTGGTGAGGCTGAACTCAAAATGGGATCTCAGAAGGCTGTGTAAAACAGTTGGTGCTACAGCTCTTCCTAGATTGACTCCTCCTGTGGTTGAAGAAATGGGACATTGTGACAGTGTTTACCTCTCAGAAGTTGGAGACACACAGGTGGTGGTTTTCAAGCATGAAAAGGAAGATGGAGCCATTTCTACCATAGTTCTTCGAGGCTCTACAGACAATCTGATGGATGATATAGAAAGGGCAGTAGATGATGGTGTTAATACTTTCAAAGTTCTCACAAGGGATAAACGTCTTGTACCTGGAGGTGGAGCAACAGAAATTGAGTTAGCCAAACAGATCACGTCATATGGAGAGACATGTCCTGGACTAGAACAGTATGCCATTAAGAAGTTTGCTGAGGCATTTGAAGCTATTCCCCGGGCACTGGCAGAAAACTCTGGGGTTAAGGCCAATGAAGTAATCTCTAAACTTTATGCAGTACATCAAGAAGGAAATAAAAATGTTGGATTAGATATTGAGGCTGAAGTTCCTGCTGTAAAGGACATGTTGGAGGCTGGTATTCTAGATACTTACCTGGGAAAATACTGGGCTATCAAACTGGCCACCAATGCTGCTGTCACTGTACTTAGAGTGGATCAGATCATCATGGCAAAACCAGCTGGTGGACCTAAACCTCCAAGTGGGAAGAAAGACTGGGATGACGACCAAAATGATTGAATGGTTAATTTTTACTGTAGGCAAAGGCTGTAGGTATAGTAGTACTCTAGGAATTGCCTGATCTTTTCCTATTCTTAAATTAAGAGGTGTTTTGTGTTTATATCCTTGGCTGGTTGATAAAATAAATGTGTTGTTACTATC