Transcript asmbl_14505

Sequence
Transcript Sequence for observation asmbl_14505 of TGE0003736:
GACACGGAACGGCTGTATTCAGTGGTGTTCCAAGAAATCTGTGGGCGCTACGGGAAGACGTACAGCTGGGACGTCAAGTCCCTCGTCATGGGCAAGAAGGCCTTCGAGGCGGCCCAGGTCATCATAGACGTGCTGCAGCTGCCGATGTCCAAAGAGGAGCTGGTGGCAGAGAGCCAGGCCAGGCTCGAAGCGCTGTTCCCCACGGCGGGCCTCCTGCCAGGGGTGGAGAAGCTGATCCACCATCTGCGAAAGCATCGCGTGCCCTTTGCCGTGGCCACCAGCTCCGGGTCCGACACCTTCGTGATGAAGACCAGCGCGCACAAAGCGTTCTTCAGCCTCTTTCATCACGTCGTGCTGGGGGACGACCCCGAAGTGAAGAACGGCAAGCCGGACCCCGACATATTCCTCGCGTGTGCGAGGAGGTTCCTCCCCCCCGCCCCCGTGGACAAGTGCCTTGTCTTTGAAGACGCTCCCAACGGGGTGGAGGCGGCCCTCGCAGCCGGGATGCAGGTGGTCATGGTGCCCGATGCACACCTGCGCCGAGACCTGACGGCCAAGGCCACCGTGGTGCTGGAGTCCCTGCAGGACTTCCGGCCCGAGCTCTTCGGGCTGCCGCCCTACGAGTGAGCGGCGGCCACGCTGCTCCGCCTGCCCCGCACCCGCGTGTCACCATCGCCACGTCGCCCTCGTCCCAGCCTCACCCCTGTGCGCTGGCTCCAAAACGATGATAGGCTGTAGCCCCACGGTCGAGAGGAAACAAGGTAGAGACAGCGGGCAGGGTGCACTGAGCACAGCTGTCCCTTGCACAGTTAGAGTTGCCTACTGTATTAGTCTTAGCATAGTCAGAGTCACACACAGTGAGCACACGTGCACACACATCCATGCTTATGTGTGAACACGCACGCAGATATGTACGCGTGTGTATACATACGTGCATAGATATGTAAAATACAAGGAAAAATGAAATTACGTTTGTGTTCATTTCTTTTTAGTTTTTCTAAACCCTGACTAGAACATGTAAAAAATGCACACATATATTTATATGCTTTAGTCCGTGTGTGTGTGTGTACGTATACATATTTATAATTTATGTTCATTGTAAATATTTACAGTGTACATAAACACTGCAGAAATTGATACTCTTTTTTGCCTTCGAAATACCTCTCGACCATATCACCGGTGGTATTTTTAGTATGAACATAATTTTAGCCTGTATCTCATACCTAGGCACATACCCACATTCAAAAATGGTTTATAGCTCAAAAATTTATCCTCTCTCCTCTGAGAACATTTATTTTTCTAATATGTGCCTTGATGTATATGTAATTTGATTTCCGAATGTGTACTTGGTACAGCCCAGAGCCACAGCACATTTCCAGGATAATTCATCAGATGTTACACTTTGGCCATTAATCCCCTTTAATTGATTTACTCTGCCTTTTGTGAGTGACAGGCATTGAAATGGGACACATACAATCACAGGGGTGTGCCTGCTTCTGTACCCTTGCAGTTGGTCTCTGTCATTAATTGTCATTGAGCTAATTTTCAACTCTCAGTTGTAGAAAAAACATAGTAATGTATGTGATTGTCTGTTGGATGATTGCCTGTGAATGATCGCCTCTGGCTGGTGACCGATTGTACCTCAGTTCAGCAGCAAATTCATTTCACATTCTCGAAGGCCTGTGTACTTGTCTGTTCTTTGAATTCTCCTTCAACTGGCTGTAACATTTCACTGGTTAGCCCGCCAGTTAATTTACTTGAATAAAATTTTTGACAGCTGTTCACATTA