Transcript asmbl_13702

Sequence
Transcript Sequence for observation asmbl_13702 of TGE0003680:
CCTTATTTGTCACTTGGTGACTGGTGTGTGCGGGGTCTGGTAGCCGCACTCTAGAAGGTTATTGCTCGCTGGCCCTCAGGTGTCCCGCTGATATCCCGGAAAATGACGGCTTCTTACGGCACGCGAACGACACCTCCCCGCTGCCACAAGAACCTTTTTCATTCTTGCCGCTTCGTTGGGATCTTTTTGATGACTCTAGTTATCCTGTTACCGACATCCTCCGATGCTTGTGATGATCCACCGAGATACGAATCTATGATGCTCAAGGATGTTTCTAAAGACTTGTATCTTCCTGGGGACCAAATAGAATTTAAGTGTCGCCTAGGATTCAAGCCTATTATACCTCTTCTTCCCACCACTGCTATTTGTCAGTCTGATAACACATGGACACCTCTCCAGGAGGCTTGTACAAGAAAATCATGTCCACAACTAGCAGACCCTTCAAATGGTCAAGTAAATGGAACTTTTCTGTTTGGTTCAGAGGTTCACTTTGTTTGTAATGAGGGTTATGAATTAGTTGGAACAAAAATTCTATATTGTGAAATTTCTGAAAATAATGTGGCTTGGAGTGGTGATCCCCCACAGTGTGAAAAGATTATGTGTCAACCACCTGGAGACATACCAAATGGAAAACATACCAGTAGCCACAAGGATGTATTTGAATATAATGAAGTAGTAATTTACAGCTGCAATCCTTCAGGAGGACCAGACGAATATTCACTTGTTGGAGAGAGCAGACTAGTTTGTTCTGGGAGAGACACATGGAGTAGTGCCCTTCCTGAGTGTAAAGTGGTCAAATGTCAATTTCCAGTAGTCAAAAATGGAAGACTGATAGCAGGATTTGCAAGAAAATTTTACTACAACGCGCAGGTTGTATTTGAATGCGTCCAGGGTTTTCACCTTAAAGGCAACAGCACAATTGTCTGTGGCGCTAACAATGAATGGCAGCCTAAGATGCCAGAATGTATTGAAGGTCTCAAGCCTACTAGTCCAGCCACATCTCCAGTTCCAAGACCCACAGATTCAGAACATGCCACTCCCGGTGATGAACCACCTAAATATTTAGGTGGAGGAATCATTGCTTTGATTGTTATTGTTACAGTTGTTGGCATTGCACTAATTTGCTGCATCGTGTGGATAGTTTTGCACAAAAAGAAGAAAAGGTTGCAGGAAAACCGTTGGGGTTAAAATTAAAGTTGCTGAGAGGGGGAANNNNNNNNNNTGCATACAGCTTACCATAATAAATCAAGCACTCCAGCAGAGCAGACAAACTAAACATTTTCCAAAAACGGGTGAAACACTTTATTTTTTGATTCTGTTAAAATGTCAAGATCTGCATTCAATTTGTATAGCTATTATTAAAACAGTATGGAGGCTCTTCAGATCATTAAAAACAGGACTATGTGGTTGACCAATTCCACTTCTGGGGATCTCTCCTAAGGAAACAAAATCACACTGTGAAAGAGATACCTGCACCTCCCTGTTCCTTGCAGAATTATTTACAGTAACTAAGACTTGGAAACAAGCTAGCTGCCATTAACAGATCATTGGATAAAGAAAATCAGGAATACATATACAGTGGAATACTACTCAGTCATAAAAACGGGAATCTTGATGACACGAATGGACCTTGAGGGCATTTTGCTATGTGAAATAAGTCATACACAGAGGCAAACACTGTGTGATCTATGTATAGAATCTAACTAACAAACTCAAAAAGAAAATCAGATTTGTGGGTGCCAGAGGGGGTGGGTTGGTATGGCGGGTTGAGGAAGTTGGGTGAAAGAGGTCAAAAGGTGCAAACTTCCAGTTATAAGCATGTATTGGGATGTAATGTATAATATAGTGACTTTAATTAGTAATACTATAGTGCATATTGGCAAGTTCCTAAGAGATCTTAACAATTCTGATCATTAGGAAGGAAAAAATTTTGTTAAATATGAGGTGATGGATGTTAACTAAATTTGTAATTATTTCATAATATACACATTACCAAATCATGCTGTAAACCTTAAACTTACAGAATGTTCTATATTAATTATATCTCAATAAAACTGGAAGGAAAATAGATCTACAAAGTTATTCTCTAGTCCTTTTCACTCTCATGAATCCAACTGTTAAGGCATAGGACTAACATTTATTATCGCTCGAAAGTAGTCACCATCCTTCGATGCTTCTTTGAAACGATATGAATTTGGTATGAACCTCGTGCCTGTTTCCCCCTAAATGACACTTGCATTTATAGGGCAAGTCAACACAGTATCCCTGGTAGTATTAAAGTGGAAAAGTGTTTTATAAAATCTCCAAATTTAGAGAAATATAGTTCAAAATGAAATTACATTTCATTTATAAAGAGTAACTTTGAAATCTTTTTTTTTTCAAAAGTTAATGCCAACTCTTAAGGTTCACTCTTTCAGCAACTCTTATGTGTACTATATATTGTTTAAAAAGTCTGTACAAATATGTATATATTACTTCAGCCTTTAAAAATTAAAAATAGAAAAATTTGGAATTTGAACGTTTGACTTTCTTAACTAAGTATATTATTGGAAAATACTTTTATAGTTAGTAGGGTAAAATTCTATTTAAAAAAATTAATGCATGGCATTTGTTCACCATTTTTAATAGCAATAACCAGAAATCAGTAATAATTTGGAATCATTTGCATACTTCTGTAAAAAGTTAGAGGGCTCTAACACCCACAACAAGAATGCCAGCTTGGTACAAAGTGAACACAGTGGCCTTGTCTTTTCAAGGAGAATTCCACTTTTTAAGACGTAGACTCCACTCTAAATTCTGGCGTAGGTGGTTTTCTCTCCCTCCTTGAAGAGATGTCTCACTTAAACAAGTCATCTAAATGCAGGCCGTTCTGCAGGGAGTAAACTCATCAGATAACCTCACGTTCTATCAGGATCTCGGTCTGTGTGTGTATCCCACCTCACCTGCTGAAAGGCAGGGTAGACCGTAAGCCATGTATTTCAGAAAAGAACGCTTAACTTTGTGTGCTGGTTGTTGGTGCTAGGAAGGGAAGAAAGAACCCCCAGGTCAGGCAGAGCTCTCCGCTCAGGTGGAATAGATGCCCCCTCTTCTGAGTCCTCACACCAGGCAGGGCACTTGCAAATGAGCCAGCTGGCAAAGAGGAGGAACCGCCCCTCTCATTCATCTTTACAAGTTTTGTTTCACACTTTTATATTTAGTACCACAAATTGGGCCAAGAAATGTTGCCTTGAGAAGGACGTGATTGGGGAATCAGAGTGGGCCAGGGCAAATACTGTTTTACTCTTATAAAGACATGTTTATAATGCACCACAAGTGTTCCTTCCCTTTGTCATCTCTGGTGCCAGACTTTAGGAAGATGAGTTTGAGCAGAAATAAACGTTTTCTGAATTAAATATAGAGAAGTTTACTACACCCATTTTCACATGCTTATTTTCAAGAATTGGCACTTGCTTAGAAGCAGAGATGGCTGTACTCTTACTTTTTTAACGTCTATTTGAGGTATTTTTCAACCAAAGCTTGTTATGCTTTACCAAAATAAAGTTTCTGCTTCAAATTTACCTTTTTTCAATTTAATATATATGAGTGATGTATGTGTAAATATTGTTTGTCAAATAATTTGTCAATTACTGAAGTATATGGGCAAACCAGTTTTCTGTAGAAAAGTTTAAATGACAGGGAAAGAAACATATTTGAACTAAAAGTGTCTTAAAACTGGAAGAATGTATTCAACAGTGAAATGGGAAGTCCTGTGTAAGAGAGGTCCTTATTGTTCATTTTTTGAAAATTC