Transcript asmbl_13072

Sequence
Transcript Sequence for observation asmbl_13072 of TGE0003662:
CTGTAGGAAGAAAAGCAATGGGAGACAGGACGTTTGCACGACTTCCACATACATTTGCAAGTACTCCGAAGGATTCAGCATTTGAGATCATAGGTCCCCTGCTGCCCTCTGAGTTCTTTCTAGAATCTGACCTGTTCATTAACTGGAACTTGGGTTCTATCTTGCTGCCTTAGTATGCCCTTTTTGAAAGAAGTGATATCTTATTTCTCCATCCTGAGAAGTGTGAATGACCGTTGCAGACAGACGGGAAGACTTAGAGCCCTGTCTCGGCAGGAGCTGGCAGCCTGGCGGTTCCTTCATTCACAATGGCTGGTCCCCTGGTGGGGACGCTGCAGCTGCTGAGACCTAACTGCAGTCTGTCCACGCTTCCTGGGACGGAAAATCCAGACCGTGTCAGTGTGATTCTTCCCCTTCTGGAAGTCAGACCTTAGTTTCCCTGTGCCCCTCGGTTCCTGTGCAGTGCCAGTTAAGGGACAGTTTATGTGGAAATCGTGCTATAAAAACAAAGTGCCAGTTTCTGTGTTGCTTTGCTCTTTGCAAACCTCTTACCTGAAAGATTGGAGGACATTTTTTTCCTTCCTGCAACTTCTCCTCTGTTGTCATAGTGCAGTGCTGACCCTCATTTTAAAAAGTTCCTTTTTGGATCTGTTCCAAGTTTTCTTTTTCCTCCAATTAGAGAGAACTCAGGTTTTAATCAGTCACACACTTGGAGTTAATTATTAGCCTCCTGTTCTTGCTAACGTTACGCTCAGGAGAGGGTCTGAAGAGGTGGAACGTTTCAAAAGAGGCCAGGGCGATCAAAGGTGGCTTCGCCCTCATTGACAGGCAGGGACGAAGAGCAGGGGCCCTGGAGCCGACCGCCTGGCTGTGCGTGACCCTTGGCCCTCCCATGATGGCCATGTGATCTTGGGCAGACGGCTTAAGCTCCCAGGCTGTTTCCTCCTCTGCAGAAGAGAAGTAATAACGTGCTAGGAATGCCNNNNNNNNNNGAGAGGAGCTTATTAATATTCCTGAACCGTGACTGTTTGACGCACAGTAAATGATATACGTGCTAAGCCAACATGGCCGTCCTCTCCAAGGAGTATGGCTTCGTGGTGCTGACGGGGGCCGCCAGCTTCATCATGGTCGGCCATCTGGCCTTCAATGTGTCCAAGGCCCGCAAGAAGTACAAGGTGGAGTACCCCACCATGTACAGCGCAGACCCCGAGAACGGACACCTGTTCAACTGCATTCAGCGAGCCCACCAGAACACGTTGGAAGCGTATCCGGCCTTCTTGTTTTTTCTAGCTGTTGGGGGTGTTTACCACCCGCGAGTAGCTTCCGGTTTGGGCCTGGCCTGGATTGTCGGACGGGTTCTCTACGCCTACGGCTATTACACAGGAGACCCTAGCAAGCGGAGCCGGGGGGCGCTGGGCTCCGTCGCCCTTCTCGGCTTACTGGGCACCACCGTGGTCTCGGCCTTCCAGCACCTCGGCTGGCTTAGACCTGGCTTGGGCAGTGAGTGCAAATCCTGCCATTAAAGAATGATAGGGTGTCTGAAAACTCTGATTTCGTCCCGAGTGACTTTTATTTCCAGTTACAGTTTTTCTAAATATAATAAAAATTTATCTGGCATCAGCCTCATACGTAA