Transcript asmbl_13030

Sequence
Transcript Sequence for observation asmbl_13030 of TGE0011527:
CGGGAAGAAGCGAAAGTGCTTTGGCGGTTTGTCCATCTGCAGCTGCGGCTCCCCCAGCCCGGTGGTCCTGCGGCCACCGCTGGCCCCAGCCTCCTCTCGCCCTTCCTTGGATCAGAGCTCGGCCGAAGCCCTCGAAGTGCGCACACACACTCAGCTTGACACCCTGGCCGACTGGTTTTAAGGGGTGTGGCAGGAGGTTTTGGACTCGATGAGTTTCCACCGAAATGTCGGAGAAGTCAGGCCAGAGCACAAAAGCAAAGGATGGGAAAAAGTATGCGACACTCAGTTTATTTAATACTTACAAGGGGAAGTCATTAGAAACTCAGAAAACCACAGTTGCAGCTCGACATGGATTACAGAGTCTTGGAAAAGTTGGAATTTCACGGCGGATGCCTCCCCCTGCTAACCTTCCAAGTCTCAAAGCAGAAAACAAAGGCAATGACCCTAATGTGAACATCGTACCGAAAGACGGCACAGGGTGGGCGTCAAAGCCAGAGCAGCATGAGGAAGAAAAAACACCAGAAGTTCCACCAGCACAGCCAAAACCTGGGGTTGCAGCTCCCCCAGAAGTAGCACCTGCTCCCAAATCATGGGCCAGTAACAAGCAAGGAATCCAGGTGAACAGTCATTTTCAGCAAGAATTTCCGAGCTTGCAGGCAGCTGGGGATCAGGAAAAAAAAGAAAAAGAAGCAACCGATGACAACTATGGACCTGGACCTAGTTTACGCCCACCAAATGTTGCTTGTTGGAGAGATGGCGGTAAGTCTGCTGGCCCACCCTTAACCTCTGACCAAGATGAAAAGCTCCCTGGCCAGGATGAAAGCACAGCTGGATCATCAGAGCAAAATGACATCCTCAAGGTGGTGGAAAAGAGGATAGCTTGTGGTCCTCCGCAAGCTAAACTCAATGGACAGCAGCCTGCCCTCACTTCCCAGTACAGAGCCATGATGCCTCCCTATATGTTTCAGCAGTATCCAAGGATGGCGTATCCTCCTCTTCATGGTCCCATGAGGTTTCCACCTTCTTTATCTGAAGCAAACAAAGGTCTTCGAGGAAGAGGCCCGCCTCCTTCGTGGGCCTCTGAGCCTGAACGCCCCTCCATCCTTAGTGCATCAGAGCTGAAGGAGCTCGATAAATTTGATAACCTAGATGCTGAAGCTGATGAAGGTTGGGCAGGTGCCCAGATGGAAGTAGATTATACAGAACAGCTGAATTTCAGCGATGATGATGAGCAAGGAAGTAGTAGTCCTAAAGAAAACAGCAGTGAGGACCAAGGTTCAAAAGCCTCTGAAAACAGTGAAACCCGAAAAGAAGCAGATGAAGTGTGCAATACTAAATCGTCATCTCAGATACCTGCCCAGCCACCAGTAGCAAAAGGTCCCTATGGGAAAGGACCACCATTTAATCAGGAACGTGGACCATCTTCCCACCTGCCACCACCTCCAAAGCTGCTTGCACAGCAGCATCCTCCTCCAGACCGACAGGCAGTACCTGGAAGACCAGGCCCTTTCCCCGCCAAGCAGCAAGTACCTGACGAAGATGAAATATGGAAGCAGAGAAGAAGACAGCAGTCAGAACTTTCTGCAGCGGTGGAACGTGCTCGTAAACGGCGTGAAGAGGAAGAGCGAAGGATGGAAGAACAGAGGAAGGCAGCTTGTGCTGAGAAATTGAAACAGTTGGATGAAAAGCTTGGTATCGTGGACAAGCAGCCA