Transcript asmbl_13029

Sequence
Transcript Sequence for observation asmbl_13029 of TGE0011526:
CGGGAAGAAGCGAAAGTGCTTTGGCGGTTTGTCCATCTGCAGCTGCGGCTCCCCCAGCCCGGTGGTCCTGCGGCCACCGCTGGCCCCAGCCTCCTCTCGCCCTTCCTTGGATCAGAGCTCGGCCGAAGCCCTCGAAGTGCGCACACACACTCAGCTTGACACCCTGGCCGACTGGTTTTAAGGGGTGTGGCAGGAGGTTTTGGACTCGATGAGTTTCCACCGAAATGTCGGAGAAGTCAGGCCAGAGCACAAAAGCAAAGGATGGGAAAAAGTATGCGACACTCAGTTTATTTAATACTTACAAGGGGAAGTCATTAGAAACTCAGAAAACCACAGTTGCAGCTCGACATGGATTACAGAGTCTTGGAAAAGTTGGAATTTCACGGCGGATGCCTCCCCCTGCTAACCTTCCAAGTCTCAAAGCAGAAAACAAAGGCAATGACCCTAATGTGAACATCGTACCGAAAGACGGCACAGGGTGGGCGTCAAAGCCAGAGCAGCATGAGGAAGAAAAAACACCAGAAGTTCCACCAGCACAGCCAAAACCTGGGGTTGCAGCTCCCCCAGAAGTAGCACCTGCTCCCAAATCATGGGCCAGTAACAAGCAAGGTGGGCAAGGAGATGGAATCCAGGTGAACAGTCATTTTCAGCAAGAATTTCCGAGCTTGCAGGCAGCTGGGGATCAGGAAAAAAAAGAAAAAGAAGCAACCGATGACAACTATGGACCTGGACCTAGTTTACGCCCACCAAATGTTGCTTGTTGGAGAGATGGCGGTAAGTCTGCTGGCCCACCCTTAACCTCTGACCAAGATGAAAAGCTCCCTGGCCAGGATGAAAGCACAGCTGGATCATCAGAGCAAAATGACATCCTCAAGGTGGTGGAAAAGAGGATAGCTTGTGGTCCTCCGCAAGCTAAACTCAATGGACAGCAGCCTGCCCTCACTTCCCAGTACAGAGCCATGATGCCTCCCTATATGTTTCAGCAGTATCCAAGGATGGCGTATCCTCCTCTTCATGGTCCCATGAGGTTTCCACCTTCTTTATCTGAAGCAAACAAAGGTCTTCGAGGAAGAGGCCCGCCTCCTTCGTGGGCCTCTGAGCCTGAACGCCCCTCCATCCTTAGTGCATCAGAGCTGAAGGAGCTCGATAAATTTGATAACCTAGATGCTGAAGCTGATGAAGGTTGGGCAGGTGCCCAGATGGAAGTAGATTATACAGAACAGCTGAATTTCAGCGATGATGATGAGCAAGGAAGTAGTAGTCCTAAAGAAAACAGCAGTGAGGACCAAGGTTCAAAAGCCTCTGAAAACAGTGAAACCCGAAAAGAAGCAGATGAAGTGTGCAATACTAAATCGTCATCTCAGATACCTGCCCAGCCACCAGTAGCAAAAGGTCCCTATGGGAAAGGACCACCATTTAATCAGGAACGTGGACCATCTTCCCACCTGCCACCACCTCCAAAGCTGCTTGCACAGCAGCATCCTCCTCCAGACCGACAGGCAGTACCTGGAAGACCAGGCCCTTTCCCCGCCAAGCAGCAAGTACCTGACGAAGATGAAATATGGAAGCAGAGAAGAAGACAGCAGTCAGAACTTTCTGCAGCGGTGGAACGTGCTCGTAAACGGCGTGAAGAGGAAGAGCGAAGGATGGAAGAACAGAGGAAGGCAGCTTGTGCTGAGAAATTGAAACAGTTGGATGAAAAGCTTGGTATCGTGGACAAGCAGCCA