Transcript asmbl_13020

Sequence
Transcript Sequence for observation asmbl_13020 of TGE0011523:
CCCATCCTTGCTTCAGCCCTGGCACCAACTTCAGCTCCAGCTCCAGCCAACTCATCCCCGACCGCCCCAGCCAACTCAACCCCAACTGCCCCAGCCAGTTCAGCCCCAGTCCCAACTCCAGCCTCACTCCCAGCCCAAGCCCCACTCCCAGCCCCGTCTCCAGCCCTAGTCAGTGTCCCAGGTCCCACCGCCTCAGCCCAAACTCAGGGACAGACTCACAAACCAGTCCAGAGTCCACTACAGACTTCAGCACAGCCTCCAAAACAGCCACCACCTTCAATTAGACTACCTTCAGCCCAGACACCTAATGGCACAGATTATGTAGCCACAGGAAAGGCCATCCAGACCTCACAGTCACATGGCACTCTAGCAACTGAACTGTGGGATAACAAGGTGGCCCCACCAACTGTGCTGAATGACATCTCAAAGAAATTAGGTCCCATTAGCCCACCACAGCCGCCTTCGGTCAGTGCCTGGAACAAGCCTCTAACGTCGTTTGGATCAGCTGCTTCATCAGAGGGAACAAAGAATGGTCAAGAAAGTGGAGTTGAAATTGGAATTGACACAATTCAGTTTGGTGCTCCAGCTTCAAACGGGAATGAAAACGAAATTGTTCCTGTGCTTTCAGAAAAAACTACTGACAAAATACCCGAACCTAAAGAACAACGGCAGAAGCAGCCACGGGCAGGCCCTATCAAAGCCCAGAAGCTTCCGGATTTGAGTCCAGTAGAAAACAAAGAGCATAAACCTGGTCCTATTGGAAAGGAACGATCATTAAAAAATAGAAAAGTAAAAGATGCCCAACAAGTGGAACCGGAAGGACAAGAGAAACCAAGCCCCACTGTCGTCAGAAGTGCAGATCCTGTGACAGCAAAGGAAACCAAAGCAGCTTCCGAAATGTCTGCTGAGATAGGAACAATGATCTCGGTGTCATCTGCAGAGTATGGCGCTAACGTGAAGGTGCCCCTGCCCAACACCCTTCCCCTCCCTAAGAGGGAGACTCTACAACAGAGCTCCAGCCTAACTTCAGTTCCTCCCACTACTTTCAGCCTCACCTTCAAGATGGAGTCTGCGCGTAAGGCGTGGGAAAATTCTCCCAACGTGAGGGAGAAGGGCTCTCCGGTGGCCTCTGCAGCGCCCCCCGTCGCCAGCGGCGTCAGCAGCGGCGCCAGCGGCCCGGGCACGGCCAGTTACAGCTCATTCTCCAGCGCGTCGGTGCCGCAGATCCCCGTCGCTTCGGTCACTCCTACGACATCGCTGTCAGGTGCTGGTACATACACTACCTCTTCTCTGAGTACAAAGTCCACAACCACGTCAGACCCGCCTAACATCTGTAAAGTGAAGCCCCAGCAGTTGCAGACAGGCAGCCTGCCCTCCGCCAGCCACTTCTCGCAGCTGAGCTGTGTGCCCTCCCTGATGGCCCAGCAGCAGCAGAGCCCACAAGTCTACGTGTCGCAGTCGGCAGCAG