Transcript asmbl_10727

Sequence
Transcript Sequence for observation asmbl_10727 of TGE0000014:
TGCTCGCCTTTTGACCCCATCATGTCGCGGGGCTCCATCGAGATTCCCCTCCGGGACACTGACGAGGTCATTGAACTTGACTTCGATCAGTTACCGGAGGGAGATGAAGTTATCAGTATTCTGAAACAGGAACACACACAACTGCACATATGGATTGCTTTGGCGCTGGAATACTACAAGCAAGGAAAAACAGAAGAGTTTGTAAAATTGTTGGAAGCAGCACGTATAGATGGCAATTTGGACTATAGAGACCATGAAAAAGACCAGATGACTTGCTTGGATACATTGGCAGCGTATTATGTACAACAGGCTCGGAAAGAAAAGAATAAGGACAATAAAAAGGATCTTATTACACAGGCCACCTTGTTGTATACAATGGCCGATAAAATTATTATGTATGATCAGAACCATTTGTTGGGAAGAGCCTGCTTCTGCCTACTTGAGGGTGACAAAATGGATCAAGCTGATGCACAGTTTCATTTTGTACTCAATCAGTCTCCAAATAATATTCCAGCCCTTCTTGGTAAAGCTTGCATTTCCTTCAACAAGAAGGATTACAGAGGAGCTCTTGCTTACTATAAGAAAGCATTGCGTACTAACCCAGGATGTCCAGCGGAAGTTCGTTTAGGAATGGGTCATTGCTTTGTGAAACTTAACAAACTGGAAAAAGCTCGTCTGGCATTCAGCAGAGCCCTGGAACTCAATTCCAAATGCGTGGGAGCATTGGTTGGACTGGCTGTTCTAGAACTCAACAATAAAGAGGCTGATTCCATTAAAAATGGTGTCCAGCTTCTTTCCAGAGCCTATACTATTGATCCTAGCAACCCTATGGTATTGAACCATTTGGCAAATCACTTTTTCTTCAAAAAGGATTATAGTAAAGTCCAGCATCTGGCCCTCCATGCATTCCATAATACAGAAGTGGAAGCTATGCAAGCAGAGAGCTGCTATCAGCTAGCTAGATCATTCCATGTTCAGGAAGATTATGACCAAGCTTTTCAGTACTATTATCAAGCCACACAGTTTGCCTCATCCTCTTTTGTGCTCCCATTTTTTGGTTTGGGACAAATGTATATTTATCGAGGTGACAAAGAAAATGCATCTCAGTGCTTTGAGAAGGTTTTGAAAGCTTATCCTAATAATTACGAAACTATGAAAATTCTCGGCTCTCTCTATGCTGCCTCAGAAGATCAAGAAAAACGAGATATTGCCAAGGGCCATTTGAAGAAGGTCACAGAACAGTATCCCGATGATGTTGAAGCTTGGATTGAATTGGCACAAATCTTAGAACAGACTGATATACAGGGTGCCCTTTCAGCCTATGGAACAGCAACACGAATCCTTCAGGAGAAAGTGCAGGCCGATGTTCCTCCAGAGATTCTCAATAATGTGGGTGCCCTCCATTTTAGACTTGGAAACCTAGGGGAGGCTAAGAAATATTTTTTGGCGTCATTGGACCGTGCAAAAGCAGAAGCGGAACACGATGAGCATTACTATAACGCCATTTCCGTTACCACGTCATATAATCTCGCCAGGCTATATGAGGCGATGTGTGAATTCCATGAAGCAGAAAAACTGTATAAAAACATCTTACGCGAACATCCTAATTATGTTGACTGCTATTTGCGCCTAGGAGCCATGGCTAGAGATAAGGGAAACTTTTATGAGGCTTCAGATTGGTTTAAGGAAGCTCTTCAGATTAATCAGGATCATCCAGATGCTTGGTCTTTGATTGGCAATCTTCATTTGGCAAAACAAGAATGGGGTCCTGGGCAGAAGAAGTTTGAGAGGATATTAAAACAGCCATCCACACAGAGTGATACCTATTCTATGCTAGCCCTTGGCAACGTGTGGCTCCAAACTTTACATCAGCCCACCCGAGATCGAGAAAAGGAAAAGCGTCATCAAGATCGTGCTCTGGCCATCTACAAACAAGTACTCAGAAATGATGCAAAGAATCTGTATGCTGCCAATGGCATAGGAGCTGTTTTGGCCCACAAAGGATATTTTCGTGAAGCTCGTGATGTATTTGCCCAAGTAAGAGAAGCAACAGCAGATATTAGTGATGTGTGGCTGAACTTAGCACACATCTATGTGGAGCAAAAGCAGTACATCAGCGCCGTTCAGATGTATGAAAACTGCCTCCGAAAGTTCTATAAGCACCAAAACACTGAAGTTGTACTCTATTTGGCCCGGGCCCTCTTCAAGTGTGGCAAGTTACAGGAATGCAAACAGACTTTGCTGAAGGCTAGACATGTGGCACCCAGTGATACAGTTCTTATGTTTAATGTGGCCTTGGTCCTGCAAAGATTAGCTACCTCTGTCCTGAAAGATGAAAAAAGTAATCTGAAGGAAGTACTTAATGCTGTGAAAGAACTGGAGCTTGCACATAGATACTTCAGTTATTTGAGTAAAGTGGGAGATAAAATGAGATTTGATTTGGCCCTTGCTGCTACAGAAGCCAGGCAGTGTTCTGACTTACTGAGCCAGGCCCAGTACCATGTGGCCCGGGCACGCAAACAAGATGAAGAAGAGCGGGAGCTGCGGGCCAAGCAAGAGCAAGAAAAGGAGCTGTTAAGGCAGAAACTTCTTAAAGAACAGGAAGAGAAACGTCTCAGAGAAAAGGAAGAGCAAAAGAAACTTTTGGAACAGCGGGCCCAGTATGTGGAGAAGACCAAAAATATTCTTATGTTTACTGGTGAGACTGAAGCAACAAAAGAGAAGAAAAGAGGTGGTGGTGGTGGACGGCGTTCTAAGAAGGGAGGAGAGTTTGATGAATTTGTCAATGATGACACTGATGATGACCTACCTATATCCAAAAAGAAGAAGAGAAGAAAGGGTAGTGGCAGTGAACAAGAAGGTGAAGATGAGGAGGGTGGTGAGAGAAAGAAGAAAAAGAGGAGAAGACATCCAAAGGGAGAAGAAGGATCTGATGATGATGAAACAGAAAATGGCCCCAAACCAAAAAAACGACGTCCACCAAAAGCAGAGAAGAAAAAGGCTCCCAAGCCAGAACGTCTGCCTCCATCAATGAAGGGAAAAATAAAATCCAAAGCCATAATTTCATCAAGTGATGACTCTTCGGATGAGGATAAACTTAAAATTGCTGATGAAGGACATCCCAGGAACAGCAACAGCAACAGTGACTCAGACGAGGACGAACAACGAAAGAAATGTGCCTCATCAGAGAGTGATTCCGATGAGAACCAGAACAAGTCTGGCAGCGAGGCCGGCAGTCCCCGGAGGCCACGAAGACAGCGGTCAGATCAGGACTCAGACAGTGACCAGCCATCCAGAAAGAGAAGGCCCTCCGGTTCTGAGCAGTCTGACAATGAATCTGTGCAGTCAGGGAGAAGCCACTCAGGAGTTTCTGAGAACGACTCTCGCCCAGCTTCTCCAAGTGCCGAATCAGATCACGAATCGGAGAGAGGATCTGATAATGAGGGTTCTGGCCAAGGCTCTGGAAATGAATCGGAACCAGAGGGATCCAACAATGAGGCCTCAGATAGAGGCTCAGAACATGGGTCAGATGATAGTGACTAGGTTTTATTTCATCAATAAGCTTCATCTCTGGAGGAAACTTTTTTAATATATGAAAGCTGTGATAAAAATGTTTCAGATGTTTAGTCAATTGTGAAATTTTTCTTAAGGCAATTTTCTTTTCTATCAGTTTGTATATTACTAAGCCCCAAGAGACATTTCCTGTGCTAGAGTCCAATATTTGAGTCTCTCGTGCAAATGAGACTATTCTTTGTGGTACAATTCCACCTATCATATGTGAAAACTGCAGTAAAAATAAACCCAGATGCTAAATCATTCCTACAAAGGTTTGACTGAAACTGTGGCAGATGTCTCATCTTCTTTATATGTTAAGCAGCATACTCTTCTGATTTTTATTGCAATCTTTTACCAAGTGGTGCACAAACTTGGTATTGATGTCTTTATTCCATTTTGAGTTTAGATTGAGAATATTTTTATTTTCTGAAGGCAGAGATATCTACTGTATAATTGCACCAAAGTACATTTGAAAGGAAGGTTTTCAATAGTGTAATACTGCAGCGATGTAGATAAAATCACAAATGTATAATGTGTTAGGTTGAATAAGGTGTGGAAAATGCTTTTCTGTTAGTAGAATGCAAAAACCTACCTAAGCCACATAATAATAAAATTCTTT