Transcript asmbl_12534

Sequence
Transcript Sequence for observation asmbl_12534 of TGE0011499:
AATGATGAAGAAGAAGAAGTAGATGATGTTGAAGAAGAAAATTCCACAAGACAGAGTGAGGATTTGGGAAGCCAGTTTACAGAAATTTTCATTAAGCAACAAGAAAATGTCACTCTCCTGTTATCTTTATTAGAGGAGTTTGATTTCCATGTCCGCTGGCCTGGTGTAAAGCTTCTTACTTCTCTTTTAAAACAGTTAGGGCCTCAGGTGCAGCAGATTATTTTAGTCAGTCCCATGGGTGTTTCAAGATTGATGGACTTATTAGCGGATTCCAGAGAAGTTATACGAAATGATGGTGTCTTACTACTACAGGCATTAACAAGAAGCAATGGAGCAATCCAGAAAATTGTTGCTTTCGAAAATGCTTTTGAGAGACTACTGGACATTATTACAGAGGAGGGAAACAGTGATGGAGGTATAGTAGTGGAAGATTGTCTAATTTTGCTCCAAAACTTATTAAAAAACAACAATTCCAATCAAAACTTTTTTAAAGAAGGCTCATATATTCAACGTATGAAACCTTGGTTTGAAGTTGGAGATGAAAATTCTGGCTGGTCTGCACAGAAAGTAACTAACCTGCACCTAATGCTACAGCTTGTTCGTGTCCTGGTATCTCCCACCAATCCTCCTGGTGCTACTAGTAGCTGCCAGAAAGCTATGTTCCAGTGTGGTTTATTGCAGCAGCTTTGCACTATCCTAATGGCAACAGGAGTTCATGCTGATATCCTGACTGAGACCATTAATACTGTATCAGAAGTTATTCGAGGCTGCCAAGTAAACCAAGACTACTTTGCTTCTGTAAATGCTCCTTCAAACCCACCAAGACCGGCAATTGTAGTACTTCTCATGTCCATGGTTAATGAAAGGCAGCCATTTGTATTGCGCTGTGCTGTTCTCTATTGTTTCCAGTGTTTCTTATATAAAAACCAAAAAGGACAAGGAGAAATTGTGTCAACACTGCTACCTTCTACCATTGATGCAACAGGTAATTCAGTCTCGGCTGGTCAGTTATTATGTGGAGGTTTGTTTTCTGCTGATTCACTTTCAAATTGGTGTGCTGCTGTGGCCCTTGCCCATGCTTTGCAAGAAAATGCCACCCAGAAAGAACAGTTGCTCAGGGTTCAACTTGCTACCAGTATCGGCAATCCTCCAGTATCTTTGTTGCAACAGTGCACCAACATCCTTTCACAGGGAAGCAAAATACAGACAAGAGTTGGATTACTAATGTTGCTTTGTACCTGGCTAAGCAACTGTCCCATAGCAGTAACACATTTTCTTCACAATTCAGCCAATGTTCCTTTTCTTACAGGACAAATTGCAGAAAATCTTGGAGAAGAAGAGCAGTTAGTCCAAGGCTTATGTGCCCTTCTGTTGGGCATTTCGATTTATTTCAATGATAACTCGCTTGAGAGCTACATGAAAGAGAAACTAAAACAACTAATAGAGAAGAGGATTGGCAAAGAGAATTTCATAGAGAAACTAGGATTTATTAGCAAACATGAGTTGTATTCCAGAGCATCTCAGAAACCCCAGCCCAACTTCCCCAGTCCAGAATACATGATATTTGATCATGAGTTTACAAAACTGGTAAAAGAACTTGAAGGTGTAATAACTAAGGCTATTTATAAGTCCAGTGAAGAAGATAAAAAAGAAGAAGAGGTGAAGAAAACATTAGAACAACATGACAATATTGTGACTCACTACAAAAATGTGATTCGAGAACAAGATCTGCAACTTGAGGAATTAAAGCAGCAGATTTCTACATTAAAATGTCAAAACGAACAGCTCCAGACAGCAGTCACACAGCAAGTATCTCAGATTCAGCAACACAAAGATCAGTATAATCTTCTTAAAGTACAGCTAGGAAAAGACAATCAGCATCAAGTTTCTTCCAGTGATGGGGCTCAAATGAATGGCATTCAACCAGAAGAAATTGGTAGGTTGCGAGAAGAGATAGAAGAATTAAAAAGTAATCAGGAACTTTTACAAAGTCAACTGGCTGAAAAGGACTCTCTGATTGAAAATTTGAAATCGTCCCTAACAACCCCTGGCACAAATGAAGCAACAGCTTCAGCTGGAGAGTCTGAACAAATTGCAGAATTAAAACAGGAACTGACAACATTAAAGTCTCAGTTAATCTCACAATCTGGGGAGATCACCAAACTACAGACAGAAAAACAGGAGCTGTTACAGAAAACAGAAGCATTTGCAAAATCAGTTCCTGTACCAGTAGAGAGTGAAACTGTAATAGCTGCAAAAACTGCTGATGTAGAAGGGAGACTATCGGCATTATTACAAGAGACCGAAGAATTAAAGAATGAAATTAAAGCTCTGTCTGAGGAAAGAGATGCTATTAAAGAGCAGCTGGACTCATCTAACAGTACCATTGCCATTTTACAAAACGAGAGAAACAAGCTCGAGGTGGATATTACAGACTCTAAAAAAGAACAAGATGATCTCTTGGTGCTGTTGGCTGATCAGGATCAGAAAATATTTTCATTGAAGAATAAACTCAAGGAATTTGGTCATCCAATTGAAGAAGAGGATGAACTTGAATCTGGAGACCAAGATGATGAGGATGACGAAGATGAAGATGACAGCAAGGACCAGAGTCATATCCAGCTTTAAAATTTCTAGGAATGCTAGAGATCATATTATAACTTTGAACATGGAGTCTTAAGACAGTGCTTTGGTTTGCTTCCACAGAAAATAAAATTTAGAAACCAAGTGGAAAACGTTCACTAATAAGACTATTGATGTATTTTTTAAACAATGCCACCCATGTTGAAAACTCTTAAAACTCTATGTAGAACATACATCTTTTATTGAAATTCATCTGAACTGTCCCAAAATATAATTTGTGAAGAGCTTGAAACACTAAAAATATACCATGTTAAGACATGTGGTGGCAGTGCTATTTGCCTTAGTTCATTGGTTGTTCACGTAAGTTCTGTTTGTTATTTTCACTTTTCAGAATTTATGACTACACATTTAATGTGTTTTGGAATCATTGTTTCTAAATTCATCATTGGAGCTCTTAGCTAATGATTTCCTTTTAAAGAAATGAAGTTGCTTAAAGGCAAGATCATATGGGCTGGAGGTGGGTATAATATATATCATCAGCCCTCGATCCAATGGGACCCCTAAGATGAGCAGGATAAGACAGTGTAGAATGAGTGCCTTGACACATGATATGGCTGTGTTCTGTACCTAAGAAACAGGATACTGACATAGTGATAAAGGAGAGCCTTTCTGAGAAACTTTTACAACAGTATGTTAGCAGGTGGTTGGTTTTGGTTTTATTTTAAGCTAAACATTAAAACAAATTATAAGTTAACGGCTCATGCAACTCAGATTTAGTATTGTTTGATTATCATAAAACATATTATGTTCCTAGTTTTAAAAAAACTATGATTTATATAATTTATTGGCATTTTTGCTGAATAGGTTTAAGTCAGATAATAGATTTTTTAAAAGCAAATGAGCAATGTGTCGAAATTTAATGTTTTCA