Transcript asmbl_12492

Sequence
Transcript Sequence for observation asmbl_12492 of TGE0003617:
GCGGCCCCTGCGAGGGTGACACACTATGATCACGGCCCCTAGAGACCGTCGTGCTGGCAAGCAGCACACCCTAGCTCCCCGGTCTGCCTCGGCCACCTCGGCAGCGCTCGAAGCCAGCAGCAGGAGTTGAGCTGCCCTGCGCCCGAGGGTTTTGGCGAAGCCCTTGGTGGCGCGCTGAGCACAGGAGGACGAAGAGGCTGAGCGTGCGCTCCTGGGTCAGGCGGTCGGCTGGGGTCGCCGCTGGAGGGGCGTTTCCGAGGAGTGGAGGAGGAGGAGGAGATGCTGCTCCTCTTCTCGCCCTCCCCAGGCTCCTTCTCCAGCTCCGCCGTCCCACACCCGCAGCCGTTTGGGGGAGAAGAGGTGGTGGCTCTCGGCGCCCGCGGCGGCTGCCCGCGGCCCGCCCCGACGCCGCGTCCCCGCAGCCCTCGCCCCGCGCTCCCGTAGCAGGACCGGGTCTGCGGCAGCGGGGTAACATGCATGTGTCACTAGCTGAGGCCCTGCAGGTTCGGGGAGGACCACTGCAAGAGGAAGAAATATGGGCCGTATTAAATCAAAGTGCTGAAAGTCTCCAAGAATTATTCAGGAAAGTAAGCATAGCTGATCCTGCTGCCCTCGGCTTCATCATTTCTCCGTGGTCTCTGCTGTTGCTGCCATCTGGTAGTGTGTCATTTACAGATGAAAACATTTCCAATCAGGACCTTCGAGCGTTCACTGCACCGGAAGTTCTTCAAAATCAGTCACTAACGTCTCTCTCAGATGTTGAAAAGATCCATATTTATTCTCTTGGAATGACATTGTATTGGGGGGCTGATCATGAAGTACCTCAGAGCCAACCTATCAAGCTTGGAGATCATCTCAACAGCATACTTCTTGGAATGTGTGAGGATGTTATTTACGCTCGGGTTTCTGTTCGGACGGTCTTGGACGCCTGCAGTGCCCACATTAGGAACAGCAATTGTGCACCTTCATTTTCCTACGTGAAACAGTTGGTAAAACTGGTTCTGGGAAATCTTTCTGGGACGGATCAGCTTTCCCGTAACAGTGAACAAAAGCCTGATCGAAGCCAGGCTATTCGAGACCGATTGCGAGGAAAAGGATTACCAACAGGAAGAAGCTCTACTTCTGATGTACTAGACATACACAAGTCTCCATTCTCTCATCAGACCTTTCTTAACAAAGGGCTTAGTAAATCTATGGGATTTCTGTCCATCAGAGATACACAAGATGAGGAAGACTATTTCAAGGACATTTCATCAGATAATAATTCTGGACATGAAGATTCTGAAAATACCTGCCCTCCTTACCAGTTCAAAACTAGTGGCCCAGAAAAAAAAGCTCTTCCTGGCTCCGATGTCCTATCCAAGAAGAAGATCTGGGCTTCATCCATGGACTTGCTTTGCACAGCTGACAGAGACTTCTCTTCTGGGGAGACCTGCAGATATCGACACTGTCTCCCTGAGGCAGTAGCAGTGCGGTCTTCAACTGCTCCTAGAAAAAAGGAAGCAAGATACTCAGATGGAAGCATAGCCTTGGATATCTTTGGCCCTCAGAAAATGGATCCTATATTTCACACACGAGAATTGCCCACCTCCTCAGCAATATCAAGTGCTTTGGACCGAATCCGAGAGAGACAAAAGAAACTTCAGGTTCTGAGAGAAGCCATGAATGTAGAAGAAACACCTCGAAGATACAAAACTTACCACGGTGATATCTTTAGTACCTCCAGCGAAAGTCCATCTATTATTTCCTCTGAATCAGATTTCAGACAAGTGAGAAAAAGTGAAGCTTCAAAGAGATTTGAATCCAACAGTGGCCTCCCAGGAGTGGATGAAACTCCAAGTCAAGGCCAGTCACACAGACCAAGCAGACAATATGAAACACCCCTTGAAGGCAACTTAGTTAATCAGGAGATCATGCTAAAACGGCAAGAAGAAGAAATGATGCAGCTCCAAGCCCGAATGGCCCTTAGACAGTCTCGGTTGAGCCTGTATCCGGGAGATACAATCAAAGCTTCCATGCTTGACATCACCAGGGATCCATTAAGAGAAATGGCCCTAGAGACAGCCATGACACAAAGAAAGCTGAGGAATTTCTTTGGCCCCGAGTTTGTGAAGATGACAATTGAACCATTTATATCTTTGGATCTGCCACGGTCTATCCTTACCAAGAAAGGGAAGAATGAGGATAATCGAAGAAAAGTAAACATAATGCTTCTGAATGGGCAAAGACTGGAACTGACTTGTGATACCAAAACTATATGTAAAGACGCGTTCGATATGGTTGTGGCCCATATTGGCTTAGTGGAACATCATCTGTTTGCTTTAGCTACCCTCAAAGATAATGAATATTTTTTTGTTGATCCTGATTTGAAATTAACCAAAGTGGCCCCAGAGGGATGGAAAGAGGAACCAAAGAAAAAGAACAAAGCCACTGTTAATTTTACTTTGTTTTTCCGAATTAAATTTTTCATGGATGATGTTAGTCTAATACAACATGCTCTGACCTGTCATCAGTATTATCTTCAGCTGCGAAAAGATATCTTGGAGGAGAGGATGCACTGTGATGATGAGACTTCTTTGTTGCTGGCATCCTTGGCTCTCCAGGCAGAGTATGGAGATTATCAACCTGAGGTTCATGGTGTGTCTTATTTTAGACTGGAGCATTATTTGCCTCCCAGAGTGATGGAGAAACTTGATTTATCATATATTAAAGAAGAGTTACCCAAATTGCATAATACCTATGTGGGAGCTTCTGAAAAAGAGACAGAGTTAGAATTTTTAAAGGTCTGCCAAAGGCTGACAGAATATGGAGTTCATTTTCACCGGGTGCACCCTGAGAAAAAGTCGCAAACTGGAATATTACTTGGAGTCTGTTCTAAAGGTGTCCTTGTGTTTGAGGTTCACAATGGAGTCCGCACACTGGTCCTTCGCTTTCCATGGAGGGAAACCAAGAAGATTTCTTTTTCGAAAAAGAAAATCACATTGCAGAATACATCAGATGGAATAAAACATGCCTTCCAGACAGAAAACAGTAAAGTATGCCAGTACCTGCTGCACCTCTGCTCCTCCCAGCATAAGTTCCAGCTGCAGATGAGAGCAAGACAGAGCAACCAAGATGCCCAGGATATTGAGAGAGCTTCGTTTAGGAGCCTGAATCTCCAAGTGGAGTCCGTTAGAGGATTTAATATGGGACGAGCTATCAGCACTGGCAGTCTGGCCAGCAGCACCCTGAACAAACTTGCCGTTCGACCTCTGTCAGTTCAAGCTGAGATCCTGAAGAGGCTATCCTGCTCAGAGCTCTCGCTTTACCAGCCATTGCAAAACAGTGCAAAAGAGAAGAGTGACAAAGCTTCATGGGAGGAAAAGCCTAGAGGAATGAGTAAATCATATCATGATCTCAGTCAGGCCTCTCTCTATCCTCATCGGAAAAATATCACTGTTAACATGGAATCACCACCACAAGCCATTGCGGAGTTGGTAGGAAAACCATTTCACCAGATGGCAAGATCTGATACAGAATCTTTGGCAGGACTCACAAAACTTAATAATTCAAAGTCTGTTGCAAGTTTAAATAGAAGTCCTGAAAGGAGGAAACATGAATCAGACTCCTCATCTTTTGAAGACCCTGGTCAAGCATATGGTATAGGAATGACTTTGCATAGTTCTGGAAATTCTTCATCCCAAGTACCCTTAAAAGAAAATGATGTACTACATAAAAGATGGAGCATAGTATCTTCGCCAGAACGTGAGATCACCTTGGTGAACCTGAAAAAAGACGCAAAGTATGGTTTAGGATTTCAAATTATTGGTGGGGAGAAGATGGGAAGACTGGATCTAGGTGTATTCATTAGTTCAATTACCCCTGGAGGACCAGCTGATTTGCATGGATGCTTAAAGCCAGGAGACCGTTTGATATCTGTAAATAGTGTGAGTTTAGAGGGGGTCAGCCACCATGCTGCAATTGAAATTTTGCAAAATGCACCAGAAGATGTGACACTTGTTATCTCTCAGCCAAGAGAAAAGACATCCAAAGTGTCTCCTACTCCTGTGCACATTGCCAATGGCATGAAAAATTACATGAAGAAAGCTTCCTATATGCAAGACGGTGCAATAGATTCTTCTGAGGATCACCACCACTGGCCACATGGTACCCCGAGGCATATCTCAGAGAGCTCTTTTGGACTGTCTGGAGGCCTGCGGGAAGGAAGCCTGAGTTCTCAAGATTCCAGGACTGAGAGTGCCAGCTTGTCCCAGAGCCAGGTCAATGGTTTCTTTGCCAGCCATGTAGGTGATCGAACCTGGCAGGAATCACAGCACGGCAGCCCTTCCCTATCTGTGATATCCAAAGCCACCGAGAAAAAGAGGACTTCTAGTGACAGTAACCAAAACAAAGCTAAAAAAACAGGCATTTCTGATACAACAGATTATTCTGACCGCGGAGATTCAGACATGGATGAAGCCACTTATTCCAGCAGTCAGGATCATCATCAAACACCAAAAAAGGGAGGTGTGAATACGAGTGTCAGACATGGTGGCATTTACGTGAAAGCTGTTATTCCCAAGGGAGCAGCAGAATTCGATGGTAGAATTCACAAAGGTGATCGTGTCCTAGCTGTCAATGGAGTTAGTCTGGAAGGAGCTACCCATAAACAAGCTGTGGAAACACTGAGAAATACGGGACAGTTGGTTCATCTGCTGTTAGAAAAGGGACAGTCTCCAGCATCCAAAGAACATGTCCCTGTAATGCCACAGTGTGCCCTTCTGGATCTGAATGCCCAAGGTGAAGAAGGCCCAGAAAAAATGATGAAGAAAATGACATATGTCAAAGACTACAACTTTGTCACTGAAGAAAATACATTTGAGGTAAAATTGTTTAAAAATAGCTCAGGCCTAGGATTCAGTTTTTCTCGAGAAGATAATCTTATACCCGAGCAAATGAATGCCAGCATAGTAAGGGTTAAAAAGCTCTTTCCTGGACAGCCAGCAGCAGAAAGTGGAAAAATTGATGTGGGAGATGTTATCTTGAAAGTGAATGGAGCCTCTTTGAAAGGACTCTCTCAGCAGGAAGTTGTATCCACTCTCAGGGGAACATCTCCAGAAGTATCCTTGCTTCTCTGCAGACCTCCACCTGGTGTGCTCCCAGAAATCGACCCTGCTCTTTTGACCCCACTGCATTCTCCAGCACAAGTACTTCCAAACAGCAGTAAAGACCCTTCTCAACCAGCGTGTGTGGAGCAAGGCACCAGCTCAGATGAAAATGAAATGTCTGACAAAAGCAAGAAACAATGCACCTCCCCATTCAGGAGAGACAGTTATAGCGGCAGCAGTGGGAGTGGAGAAGAAGACTTAGTGAAAGCTCCAGCAAAGATAACAAATACAAGCTGGAGTTCAGCTTTGCATCAGTCTCTAAGCAACATGGTATCACAGGCACAAAATCAGCATGAGGCAACCAAGAGTCAAGATGATACCGTTTGCACCATGTTTTACTATCCTCAGAAAATACCTAATAAACTAGGACTCGAGGACAGTAATCCTTCTTCCCCTCTACCACCGGATGTGACTCCTAGGCAACCCCAAACAGAATCCACTTCCACTAATTCAGTGGATAAATATCATACACATCATATTTCTGAACCAACTAGACAAGAAAGCTTGACATCTTTGAAAAATGACTTGGAAAACCACCTCGAAGACTTTGAAATGGAAGTAGAACTCATCATTACCCTAATTAAATCAGAAAAAGGAAGCCTGGGTTTTACAGTAACCAAAGGCAATCAGAGTATTGGTTGTTATGTTCATGATGTCATTCAAGATCCAGCCAAAAGTGATGGAAGGCTAAAACCTGGGGACCGCCTCATAAAGGTTAATGATACAGATGTTACAAACATGACTCACACAGATGCAGTGAACCTGCTCCGAGCTGCACCCAAGACAGTCAGATTAGTCCTTGGACGAGTTCTAGAATTACCCAGGAAGCCAGTGCTGCCTCATTTGCTACCTGACATTACATTAACATGCAACAAGGAGTTGGGTTTTTCCTTGTCTGGAGGTCACGACAGCCTTCATCAAGTAGTGTATATTAGTGGTATCAATCCGAGGTCAGTTGCAGCCATTGAGGGTAATCTCCAGCTGTTAGACATCATCCACTATGTGAATGGAGTCAGCACACAAGGCATGACCTTGGAAGAAGCGAAGAGAGCACTAGACATGTCACTCCCATCAGTGGTGCTGAAAGCAACAAGAGATGGTCATCCAGTGGTCCCTAGTTCCAAGAGTTCTGCTGTTTCAACTCCAGAATCAACTAAAGCTAATGGTCATCACAATGTGGATCCTTGTGGCAAGCCTGCCCTCACTCCTAATAATTCCTTCTCCAAGGCTAATGGGGAAGAAATAATTGAAGTTTTGTACCCTGAAGGAAAATGCTCTACTCATCAAATGAAGGGATCAGCAAATTTGATTCTGTCCAAAGAATCTGATGTACAAGAAGATGATATTTATGATGATCCTCAAGAAGCCGAAGTTATCCAGTCTCTGCTGGATGTTGTGGATGAGGAAGCCCAGAATCTTTTAAACAAAAATAATGCAGCAGGAGATGCCTGTGTTCCAGGTGCACTGAAAACCAATGGGAAGTTATCTGAAGAGAGAGCAGAAGATACAGACTGTGATGGATCACCTTTACCTGAAGATTATACAGAGTCTACCAAAATGAATGGCTGTGAAGAATATTGTGAAGAAAAAGTAAAAAGAGAAAGCTTAACTCAAAAGTCACAAGAAAGGAAGACTGATGATTATGAAATAACATGGGGAAGTGACGAATTGCCAACAGAGACAACAAACCACGAAGATTCCATTAAAGATCATCCCCTTCTGACACATGAGGAGCTTGCTGCACTCCCCATCGTCAAAGTGCTTCCCTCTGGTAAATACACTGGTACCAAGTTGAAATCAGTCATTCGAATGATGCGGGGTTTACTGGATCAAGGAATTCCTTCTAAGGAGTTGGAGAATCTTCAAGATTTAAAACCTTTGGATCAGTGCCTAATTGGACAAACTAAGGAAAATAGAAGGAAAAACCGATATAAAAATATACTTCCCTACGATGCCACAAGAGTGCCTCTTGGAGATGAAGGTGGATATATCAATGCCAGCTTCATTAAGATACCAGTGGGGAAAGAAGAATTCATTTACATTGCCTGCCAAGGACCTCTCCCTACAACTGTTGGAGATTTCTGGCAGATGATTTGGGAACAAAAATCCACAGTGATAGCAATGATGACCCAAGAAGTAGAAGGGGAAAAAATAAAATGCCAGCGCTATTGGCCTAACATCCTAGGCAAAACGACAATGGTCAGCAACAGGCTTCGGCTGGCTCTCGTGAGAATGCAACAGCTAAAGGGCTTCGTAGTAAGGGCAATGACCCTAGAAGATATTCAAACAGGAGAGGTGCGACATATTTCTCATCTGAATTTCACTGCTTGGCCAGACCACGACACACCTTCTCAACCAGATGACTTGCTTACTTTTATCTCTTACATGAGACACATTCACAGATCGGGCCCAATTATCACACACTGCAGCGCTGGCATCGGACGTTCAGGGACCCTGATATGCATAGATGTGGTTCTAGGATTAATCGGTCAAGATCTTGAATTCGACATCTCTGATTTAGTTCGCTGCATGAGACTACAAAGACATGGAATGGTCCAGACGGAGGATCAATATATTTTCTGCTACCAAGTCATCCTTTATGTCCTGACACGTCTTCAAGCTGAAGAAGAGCGGAAAGAGCAGCCACAGCCTCTGAAATGACCTGAAAAGAACAGCCTTCTGGATGCCTTTCCCACTCTCTTCATAACCTCCAATAGTTGCTCCTGCTCTCCATTATAAAATAAGGATCCCAAGGCCATAAGTCCATACAATGTCTATACTTATTCTCCTCTACCTTAGAGGGGCATTCTTCATAACAACAAATAATGTTGAAATGCTGTATTTTTACAGCTGCTTTAACCTGTGACAATTGTTTTAAAATTTTTAACACAAAATAATGCAGATCTTAGGCACAAGTAAGGCAGCATTTGATTATAGTGGACATTGTTATAAGGATGCACTGAGTTTATTTTAAATGTACCAATCTTGTTTATAGCAAAATTCTTTTTCAGTATTTTAATAGTTATTTTATAGGGGATACAGTATTTAAGCTTTAAATGACAGTAGTTTGGGCATAGAAAAAAAGTAGCAAAGGTTTACTGTATCAATTTCTGATGTTTACTATATAGAATTTCCTGTAATATATTTATATACTTTTTCATGAAAATGGAGTGATCAGATATGTTTGTAACGGCATCATCTATGTTTGATATGCATCATCTCACTTTGTAAATAAAAAAACACCTTAAAACATGAACAAA