Transcript asmbl_12089

Sequence
Transcript Sequence for observation asmbl_12089 of TGE0003604:
AGTTAACCTCTTTTCCGGTTTTTGTGGCGCGCGGCATCATGAGCAGCAAAGTCTCTCGCGACACCCTCTATGAGGCTGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGGAAGTTTTTGGAGACGGTGGAGCTGCAGATCAGCTTGAAGAACTATGATCCTCAGAAGGACAAACGCTTCTCTGGCACCGTCAGGTTGGCACCGTTCTGACCCCACCCAGCACTCAGTGCCCCCCGTGCCCTGCTACTCTCTTGAGGCTCCTTTTGAGCCCTTGATGGGCAGGCACGTGCTGCACTGAAGTGCCCGGGTAGTTCAGACCCTCTGCTTTGGGCAGGTGCGGCTGGACGGACCCCCACCCTGGGTCTTAAAACAAGAGGGGAGGCGTGGGGAGGCCTTGGCCGAGCCCGCCGGCTAGTTTGAGAAGCCAGACTAGCTGTTGGTGAATGTGAACGCTCTGGGCTTAAGTCCACTCCCCGCCCAAAGTTCTCTGTATGTGTTCTGGGGGATCAGCAGCACTGCGATGAGGCCAAGGCTGTGGATATTCCCCACATGGATATCGAGGCATTGAAAAAACTCAACAAGAATAAGAAACTGGTCAAGAAGCTAGCCAAGAAGTATGATGCCTTTTTGGCTTCAGAGTCTCTGATCAAGCAGATCCCACGAATCCTGGGCCCAGGCCTGAATAAGGCAGGCAAGTTCCCTTCCTTGTTGACCCACAATGAGAACATGGTGGCCAAAGTCGATGAAGTGAAATCCACAATCAAGTTCCAGATGAAGAAGGTGCTATGTCTAGCAGTGGCCGTTGGCCACGTGAAGATGACAGATGATGAGCTTGTGTATAACATCCACTTAGCTGTCAATTTCTTGGTGTCATTGCTCAAAAAGAACTGGCAGAACGTCCGGGCTTTATACATCAAGAGCACCATGGGCAAGCCCCAGCGCCTGTACTAAGGCACAGCTTAATAAACCATACTGTTACCATTA