Transcript asmbl_11776

Sequence
Transcript Sequence for observation asmbl_11776 of TGE0003598:
TGTTTGCTGGGGACCTGGCACAGGTGGGGGAAGGAGGAGTAATGGTTCTCTATGAAGTGGATTCTAGAAGGAGAAGACGGGAGAGCTGGGGAAGACTGTGGGACTCGGCGGTGTTGGGTAGTTCCGGTAGGGCGGGGCGCGGCCGAGGTCCCCAGACCAGAACTGGAGAGGATATTCGGGATCCCTACTCCGCTAGTGGAGAAAGGACCTGCCTCCCACGCACCCTCACCTAACCAGAGCGGGGATTTCTATGGCCCCTCCTGCTGGCTTTTTGAAGAAAGCGAAAGTGAAAGAGGGAAGAAGACTGAGGAGATCGCGGCGCCATGAAGCACCTGTCCCTGCTCCTCGCTCTGGCTTTGGGCTTGGTGACCGCCGTCTCGGCGGGACCCACGGTGATAGAATGCTGGTTCGTGGAGGATGCAGACGGGGGCCGCCTGGCCAAGAAACCCGCTGCATTGCTGCTGCGCCAGGGCCCAGGGAGAATACCTCCCCGGCCGGACCTCGACCCCAAGCGCTACCTCAGAGTACATGACCCCACAGGCACCCTGCAGGCTGCCTTCAGGCGGTACCCCCGGAGCGCCCCCACGCCACACTGCGAGATGAGCCATTACATCCCACTCCCCGCCTCTGTGAATTGGGTCAAAGGCCTGACTCCGGAGCAGAGCTGCCCGCGGGCCTTGGACGGGACTTGGTTCATGGTCAGCATGTCCAGCCCGGTCCTCAGCCTCTCCAGCCTCCTACAATCACAGACCGAGCCTCAGCCAGATCCTGGACTCATCACCATGGCAACAGCTGTGCTGACTGTCATCACCCACAACCCCACCACTAGAATCCAGCTGGGACAAGATGCTCTGCTGGACTTGAGCTTTGCTTACATGCCCTCCACCCCAGAGGCCACTACACCTCTGGCCCCAGGTCCCCCTCCCTTTGGGCTGGAGTGGCGACACCAGCACCTAGGGGAGGGGCACCTGCTCCTGGCTGCAACTCCTGGGCTGCGTGGGCAAATGCCAGCTGCCCGAGATGGGGCAGTGGCATTTGCCGCTTGGGATGATGATGAGTCATGGGGTCCATGGACTGGAAATGGGACCCTCTGGCTGCCTGCAGTGAAGCCTTCCCAGGAGGGTGCCTATCAGGCCACCATATACCTGCCATATCTGCAAGGACAGGTCACCCTGGAGCTTGCTGTGCAGAAATCCCCCAAAGTGTCCCTGATGCCATCACCTCTTGTATGGGCTGCCCCTGGGGAGGCACCCCCTGAGCTAGTTTGCCTTGTGTCCCACTTCTACCCCTCTGAGGGCCTGGAGGTGGAGTGGGAGCTCCGAGGTGGTCCAGAGGGGAGCTTTCAGAAGGCCAAGGGGCAGAGTTGGCTCTCAGCCCTGCACCACCACTTGGATGGCTCTGTCAGCCTCTCTGGGCACCTGCAGCCATCCCCGGTCACCACTGCACAGCACGGGGCGCGCTATGCCTGTCGTGTCCACCACCCCAGCCTACCCGCATTGGGGCGCAGTGCTGAAGTCACCCTGGAGGTGGCAGGTCTCTCTGGCCCCTCCCTGGAGGATGGTATAGGCCTCTTCCTGTCTGCTTTTCTGCTCTTGGGGCTCTTCAAGGTACTGGGCTGGGCAGCTGCCTACCTGTCCACTTCCAAGGAATCAAAGAAGAAAGCACAGTGAGGGCACTCAAGACCACCCTGGGGAAGCTACCATCATCTCTGACCTGAACTACTGTAGTAGCTCCTCCAAACAGTATGCCATCACCTGCTCCTGCTCCTGCTCCTTCCAATCTCTCTCCACGGTGGGAATGCTTTTTTAAAAAAGACACAAATCTATAGCATTCACCTTCTTAGAGCTCTAAGGCTGTGGTTCTCAAAATTTTTGGTCTCAGGACATCATAAAAACGAAGGACTCTCGAGCTTTTGTTTATGTGGGTTATAAACTAACTATTTATCATACTAGAACTTAAAACTGAGAAAAGTTTAAAACAGAAGGATACACAGGCACACATTCCATTGGCTGTGAAGGAGATAATGTCAATACACATCATGTAGCTCTGGGAAATTTCACTGTACATTTTTTTAGAGAATGAAAGTGAAAAAGGCAAATAACATTTTAGTGTTATGAAAATAGTCTTAACTTCGTATGCGCAGTGAATTAGTCTCAGAGATCTCTGGGGCAGGGACCACACCAAGAGAACGGGTGCTCTAGAGGCCAAATCCATTCTTCTTGCCCTTGGCACATGAATTTACGGCGCTGGAGCCACTGCTTACCTCTTCAACCCAATCTGGTGCTCTCCAGCACTCTCAATACTCATCACACCTACAGCTCTTCCTTTCCTCCAATGGCCTCTCACCTTCCCTAGGTCCCAGAGTTCTGTTCTCTCTGCCTGGTCCACCCTCGCTCTCCCTGGGCTCCAGACCAGATCAGCCAAGTCATTCCCCTCAGACCGCCGCGTGTCCCTCTTGTGCGGTTCACCACGGTTGTACTTAAGTGATTGTGCGAGTTGTTAAAGCCCGTTTCCCGGACTCTCAGCTCCTCGCAGTTGCAAAAACAAGTCTGTATGTCCACTGCTTTATCTCCCGCATCGGCAGTGGGCCTGGCGCCCACTGGAGGGCGCTCGGTATAAGAAGTTATAGTCCTTTTTTTCATCCTAAGGATTCAAAAACAGGTATAGGGTCAAGTAACTACTGGACGAAGGAAGCGGCGACTTAAGGACCTCCGAGGGGCAGGACCGTGGGCCAGACCGACGCGGGGAGCGAGTCTACTCGGTGGGAATAAAGTTGTGTTCCAGTGCTTCCAACGGCTGTCTCATTCTACCCCAGGGTCCCCTTTCCAAGCA