Transcript asmbl_11645

Sequence
Transcript Sequence for observation asmbl_11645 of TGE0011479:
GTCAGTCAGTCGGCGGGTCAGCGGGTCGGTGGGACTCTTCGGGGGTGCGTTGTCATTTGCAAGTGAGGCGTCTGGCCTCGGACTGAAGAAGCCATGCCTTTACGACTTGATATCAAGAGAAAGCTAACTGCTCGATCTGATCGAGTTAAGAGTGTCGATTTGCATCCTACAGAGCCATGGATGTTGGCGAGTCTTTACAATGGTAGTGTGTGTGTTTGGAATCATGAAACACAGACACTGGTGAAAACATTTGAAGTGTGTGATCTTCCTGTTCGAGCTGCAAAGTTTGTTGCAAGGAAGAATTGGGTTGTGACGGGAGCGGATGACATGCAGATTAGAGTATTCAATTACAATACTCTGGAGAGAGTTCACATGTTTGAAGCACACTCAGACTACATTCGCTGTATCGCCGTTCATCCAACCCAGCCTTTCATTCTAACTAGCAGCGATGACATGCTTATCAAGCTCTGGGACTGGGATAAAAAATGGTCTTGCTCACAAGTGTTTGAAGGACACACCCATTACGTTATGCAGATCGTGATCAACCCCAAAGATAACAATCAGTTTGCCAGTGCATCTTTGGACAGGACCATCAAGGTATGGCAGCTGGGCTCTTCGTCACCAAACTTCACTTTGGAGGGACATGAGAAAGGCGTCAATTGCATCGATTACTACAGTGGTGGCGACAAACCATATCTCATTTCAGGTGCAGATGATCGTCTGGTTAAAATATGGGACTATCAGAATAAAACATGTGTACAGACACTGGAGGGACATGCCCAAAATGTGTCTTGTGCCAGTTTTCATCCTGAGTTGCCAATCATCATCACAGGTTCAGAAGATGGCACCGTGCGTATATGGCACTCAAGCACATACCGCCTTGAAAGCACACTGAATTATGGAATGGAGAGAGTATGGTGTGTGGCCAGCCTGAGAGGGTCCAACAATGTTGCTTTGGGCTATGATGAAGGGAGTATCATTGTTAAGCTTGGTCGGGAGGAACCTGCCATGTCCATGGATGCCAATGGAAAGATAATTTGGGCCAAGCATTCAGAAGTCCAACAGGCCAACCTAAAAGCAATGGGAGATGCTGAAATTAAAGATGGAGAAAGATTGCCACTGGCAGTAAAGGATATGGGCAGTTGTGAAATATACCCTCAGACTATTCAGCACAATCCTAATGGGAGGTTTGTTGTGGTGTGTGGTGATGGCGAGTATATCATCTACACAGCAATGGCATTGAGAAACAAGAGCTTTGGGTCTGCCCAGGAGTTCGCATGGGCCCATGATTCTTCAGAATATGCAATAAGAGAAAGCAACAGTGTTGTAAAGATATTTAAGAACTTTAAGGAAAAAAAATCATTTAAACCAGATTTTGGAGCTGAAAGTATCTATGGAGGCTTCTTATTGGGAGTCAGGTCTGTAAATGGCTTAGCTTTCTACGACTGGGACAATACAGAACTCATACGCAGAATTGAAATTCAGCCCAAACACATTTTCTGGTCTGACTCTGGAGAGCTAGTCTGTATTGCTACTGAGGAGTCATTTTTTATCCTTAAGTATCTGTCAGAAAAAGTCTTGGCTGCACAGGAAACACATGAGGGAGTCACTGAAGATGGCATTGAAGATGCCTTTGAGGTTCTTGGTGAGATTCAGGAAATTGTGAAAACAGGGCTGTGGGTAGGCGATTGCTTCATTTACACAAGTTCTGTGAACAGATTAAATTATTATGTCGGAGGAGAAATAGTCACCATTGCCCACTTGGACAGGACGATGTATCTCCTGGGCTATATCCCTAAAGACAACAGGCTTTATCTGGGGGATAAAGAACTGAACATCGTT