Transcript asmbl_11643

Sequence
Transcript Sequence for observation asmbl_11643 of TGE0003585:
TGGAGAGGGCTTGTCCCGGGGCTGCCCCGCCGCAGAGGTCCCTGTGACCCCAGACCAGGCGCTGTCCCCGCCCGGCCCTCGTGTGCAGGACTGCGCTCGGGCCCTGCCAGAGCCCCGGTTCCGCGCGGCCGATGTCCCAGCCGCCGGAAGTTGCCCGAGGCTCGCCGAGCGCCTCTGAGGAGCCCGGCGTCGCGCAGGCAGAGTGGCCACTGCAGTGGGTGTAGATGTGCCTGACGAGATGAAGAGCCGAATCCCTGTGGTGCTTTTGGCCTGTGGCTCCTTCAACCCCATCACCAACATGCACCTGCGCTTGTTTGAGGTGGCCAGAGACCACCTACACCAAACAGCTGTGCCTGAACTGAAGCTCCTCTGCGGGGCAGATGTCCTGAAGACCTTCCAGACCCCTGACCTCTGGAAAGACGAGCACATCCAGGAAATAGTGGAGAAGTTCGGCTTAGTGTGTGTGGGCCGGGTAGGTCACGACCCAAAGGGGTACATCTCAAGCTCCCCCATCCTTCAGAGATACCAGCACAACATTCACCTGGCCAGGGAGCCTGTGCAGAACGAGATCAGTGCCACGTACATCAGGCGGGCCTTGGGCCAAGGGCAGAGCGTGAAGTACCTGCTCCCAGACGCTGTCATCGCCTACATCAAGGACCACAACCTTTATACCAGGGGCAGTTCCTGCAAAGGCAATAACACCCAGAACAACTTAGGAAAGACAAGCTAGGGAGGGCCAAACCCTCCTCCACCAAGCTCCTCCTGAGGAGAGGGCCGTTAAGGTCTTTCCTTTTTTTCAGCTTTTTCCTTTTTCCTTTGTTCTAGTTCAACAATGATTTTACTTCTGAAGAGTCTTCTATCCCAGAAAGAGATAACTTCTTTTGGTAGGAGCTAGTATCTACACAAGAATAGACGTTTATCAAAAAAGTTCAAATGGTGTAGCAGGTCATTAGGATTGGGCGAAAGCTCTCAGAATCTCTGGGTGAAGAGACCTGCTTATTTTGTAAATGGTTGTATGCACACTGGAGGTGGTTCCACGTATGGCAGGGGCCCCTGACGGTCAGATCAGAATTGCCCACAATGCATTTTTTAACTAGGACCAGGTGCAGCATGCTGGTCATGATTAGAAAAACTGGACAGAATGCTAATTACCAAACAGTGGGCTATGTCAACGCCATGTTGAAAACGAAATAATAACCGAAGAGTCAAAAACTTGGAAGCAGCACTTTGCTGATTTACAGTGAATCTTCTGTTAAGAACCGTGCTCTGCCTGTCCCCTGGATGTTGATAAAATTTAAACTAAAATTTTTCTAAGTAGTGATCCTCCAACTATTTTTGAAACAGCAAATATTTTTAGTGCAGCTCTTCTATAAATATCAGGGCTCCTGGTTTCCAGGTTCCTGAAAAGGAACTGGGGTAAGACAGATGCCTTGACTGTCTTAGAGGATCTTTTTGAATGTTTTATGATTGCCTGCCTGTTTGAGTATTGGCAAAGGGCTAAATAATAAATAGACATCAAAAAGTA