Transcript asmbl_10855

Sequence
Transcript Sequence for observation asmbl_10855 of TGE0003539:
GTGAGCCCTGCGGTCTCGGGGGAGGAGGCAGCGCGCAGGGAGCAGCGGGAAGGCGCTCGGGAGCCGGAGCGGGCGCGGCGGCGGTGGGCCCGAAAACACTAGAATCTTCTGGTGCCATCAGAAATGTCTCCCTTAAGTGGCAAAGTCCAGACTGTCTTGGGGCTGGTGGAGCCGAACAAACTGGGCCGCACCCTGACCCACGAACATCTGACAATGACCTTTAACTGCTCTTACCACCCACCGCCTCCATCTCATGAAGCTCTCTCTCGGGAGCCTATTATGATGAAAAATTTGTTTTGGATTCAGAAAAACCCTTACTCCCATAAAGAGAATCTTCAGCTGAATCAGGAGACGGAAGCCATCAAGGAAGAACTGTTGTATTTTAAAGCCAAAGGTGGAGGGGCCTTGGTGGAGAACACGACCACTGGGATCAGCCGCGACGTGCAGACTTTGAAGCGGCTGGCGGAAGAGACGGGCATTCACATCATATCTGGAGCTGGGTTTTACGTGGATGCAACTCACTCTTCTGAGACCAGAGCCATGTCGGTGGAGCAGCTGACTGACGTCCTCGTTAATGAAATTCTCCATGGAGCTGATGGGACCAGTATCAAGTGTGGCGTTATTGGAGAAATCGGTTGCTCCTGGCCTCTGACTGACAGTGAAAGGAAGGTTCTCCAGGCGACGGCTCATGCCCAGGCCCAGCTCGGCTGTCCTGTTATCATTCACCCTGGAAGGAATGCAGCCGCACCCGTTCAGATCATCCGAGTACTGCAAGAAGCAGGTGCAGACATCTCCAAAACAGTTATGTCGCACATCGATAGGACTATACATGATAAGAAGGAACTACTGGAGTTTGCTCAACTTGGCTGTTACTTGGAATATGATCTCTTTGGTACCGAACTCCTTCATTACCAATTCAACCCAGATATTGACATGCCTGATGATAATAAAAGAATTAGAAGGGTGCGTCTTCTGGTGGATGAGGGCTATGAAGATCGAATTCTGATGGCACACGACATACACACGAAGCACCGGCTGATGAAATACGGAGGTCACGGCTATTCTCACATACTCACCAACGTTGTCCCTAAAATGTTGCTCAGAGGTATAACTGAGAATGCGCTTGATAAGATACTGATAGAGAACCCTAAGCAATGGCTGACTTTCAAATAGGATGGTTAGGAATTCACACCTTGAGCATAAAGCTTACAGAGATCATCCGGTGGTTTCGAACCCAGTGAGTTATCAATCAGACCTACATAGGGCTAATGACAGATCATTTGCATTTTATGGGAATTAGAAGAGTTTTCCCTTCTCAGAAACTGGCTATTACATCTGAACCTGCAAGGGGCCTCACTCAGCCCACTGCCTTAACAAAATAAATACACAAAATACCTATTTCCAAACCATGATTTACAGTCTATATCCTCTTGGTAGAGTTTTGTTTTGTTTTGTTTTCTTAA