Transcript asmbl_10552

Sequence
Transcript Sequence for observation asmbl_10552 of TGE0003530:
AGCATCCATTGAATTTATTCGACGTAACCACAGAGGTACCGTCTTCATACCGCCACACAGACACAAACACAGCCACAGCACAATGTCCATATCGGCGCAGGCGCACTCCTTCTGCGGCTCATTTATACGTCTTCATGTGCCACAGTCCGTCGTTTAGATAATGGATATTTTCGATGCCGATCCCCTTGTTGACTTTCTCGATGTCTTCCGCAGACATCTTCATGACTCCGACACACAGGGCGTGCTGTTTTCCTTCCGCCATGATGGCCACCACCGTATCCACCGCGGCAGGGTACAGCTTGGCCCCGGGAGACGTCAGGCCTGGACACATGATGTTCGCGCCACTGAGGACAAATTTGATGGCTCCTTTATCCACCTGCTGGCGCGGCAGGATAAACGGGTACTTGTGGAGCAGCCTCAGCGTCGGGTAAAAAGGCCCTTCTCTTTGTCTAAAAAACAGCAGCTCCCCGTTGACCGTGAGGATCTCTATGTGCTCGTGGCACCGCACTATTTTGACGGGGTCTTTCTTGGGCATGATTTGGTTAAGCCACGGTTCGATGCCTGGAAACTGCTCTGTCAACTGGTTCTTAATGCCCTTAATAACGGACGTTTTCAGCTGGATGCAGTTGGACACGTTTTCCTTCTCGTCGAATTTCTTGAACATGATCCAAGGTGAAGGGGGCGACAGTACGGAAACGCCCGCAACCAGGGAAAAGCTGATCCCGCGAGGCTCGGGCAGGAGCGCTTACCCGCGGAGCGCCGGCGAGACGGTCGCGG