Transcript asmbl_10431

Sequence
Transcript Sequence for observation asmbl_10431 of TGE0011429:
GGGTCTTTTGGTACGTGCAGTCCGAGGTTGCCATGGATCGGATGAAGAAGATCAAACGGCAGCTGTCAATGACACTCCGAGGGGGCCGAGGTGTAGACAAGACCAATGGTGCCCCTGAACAGATAGGCCTGGATGAGAGTGGCGGTGGCGGCGGCAGTGACCTTGGAGAGGCCCCTACTCGTGCAGCCCCTGGAGAACCTCGCTCTGGACGGGGACCACTCAGCTCTGCACCAGAGATTGTACACGAGGACTTGAAGATGGGGTCTGACGGGGAAAGTGACCAGGCTTCAGCCACATCCTCAGATGAGGTGCAGTCGCCAGTGAGGGTGCGCATGCGCAACCATCCCCCACGCAAGATCTCCACTGAGGACATCAACAAGCGCCTATCACTACCAGCTGACATCCGGTTGCCCGAGGGCTACCTTGAGAAGCTGACCCTCAATAGCCCCATCTTCGATAAGCCCCTCAGCCGCCGCCTCCGTCGTGTCAGCTTGTCCGAGATTGGCTTTGGGAAACTGGAGACATATATCAAGCTGGACAAGCTGGGCGAGGGTACCTATGCCACCGTCTACAAAGGCAAAAGCAAGCTCACAGACAACCTTGTGGCACTCAAGGAGATCAGACTGGAACACGAAGAGGGGGCACCCTGTACGGCCATCCGGGAAGTGTCCCTGCTCAAGGACCTCAAACATGCCAACATCGTCACACTACATGACATTATCCACACTGAGAAGTCCCTCACTCTTGTCTTTGAGTACCTGGACAAAGACCTGAAGCAGTACCTGGATGACTGTGGGAACATCATCAACATGCATAATGTGAAACTGTTCCTGTTCCAGCTGCTCCGTGGTCTGGCCTACTGCCATCGGCAGAAGGTGCTACACCGTGACCTCAAGCCCCAGAACTTGCTCATCAATGAGAGAGGAGAGCTTAAGCTGGCTGATTTTGGCCTGGCTCGGGCCAAGTCAATTCCAACAAAGACCTACTCCAATGAGGTGGTGACACTATGGTACCGGCCCCCTGACATCCTGCTTGGGTCTACAGACTACTCCACCCAGATTGACATGTGGGGTGTGGGCTGCATCTTCTATGAGATGGCCACGGGCCGGCCCCTCTTCCCAGGCTCCACAGTGGAGGAACAGCTACACTTCATCTTCCGCATCTTGGGAACCCCAACTGAGGAGACATGGCCGGGCATCCTGTCCAACGAAGAATTCAAGACATACAACTACCCCAAGTACCGCTCTGAGACCCTTTTGAGCCATGCACCCCGGTGAGGCTGGTGGGTAGGTGGGTGTTAGGGGCAAGAGTGCCCAAGCTCAATTTAAAGCGGGTTTCCTTG