Transcript asmbl_10427

Sequence
Transcript Sequence for observation asmbl_10427 of TGE0003514:
GTGAGACCAAGTAGGGGGAGCGAATGGTGACTGGTACGCTGGGCTTACTGGCTGCTGCCCACTTCAGCGCTAGCACACTTCTGTAAGATCGGAACTGAGTACTAAACAACCTCTACACTTCCCCCTGGCGCCATTCCAGGGCTGGCGCCACATTCCCTGGTGGGCACGCAATGGCCGCGCCCCCTCCAGCGGCGGACGGGTCTTTTGGTACGTGCAGTCCGAGGTTGCCATGGATCGGATGAAGAAGATCAAACGGCAGCTGTCAATGACACTCCGAGGGGGCCGAGGTGTAGACAAGACCAATGGTGCCCCTGAACAGATAGGCCTGGATGAGAGTGGCGGTGGCGGCGGCAGTGACCTTGGAGAGGCCCCTACTCGTGCAGCCCCTGGAGAACCTCGCTCTGGACGGGGACCACTCAGCTCTGCACCAGAGATTGTACACGAGGACTTGAAGATGGGGTCTGACGGGGAAAGTGACCAGGCTTCAGCCACATCCTCAGATGAGGTGCAGTCGCCAGTGAGGGTGCGCATGCGCAACCATCCCCCACGCAAGATCTCCACTGAGGACATCAACAAGCGCCTATCACTACCAGCTGACATCCGGTTGCCCGAGGGCTACCTTGAGAAGCTGACCCTCAATAGCCCCATCTTCGATAAGCCCCTCAGCCGCCGCCTCCGTCGTGTCAGCTTGTCCGAGATTGGCTTTGGGAAACTGGAGACATATATCAAGCTGGACAAGCTGGGCGAGGGTACCTATGCCACCGTCTACAAAGGCAAAAGCAAGCTCACAGACAACCTTGTGGCACTCAAGGAGATCAGACTGGAACACGAAGAGGGGGCACCCTGTACGGCCATCCGGGAAGTGTCCCTGCTCAAGGACCTCAAACATGCCAACATCGTCACACTACATGACATTATCCACACTGAGAAGTCCCTCACTCTTGTCTTTGAGTACCTGGACAAAGACCTGAAGCAGTACCTGGATGACTGTGGGAACATCATCAACATGCATAATGTGAAACTGTTCCTGTTCCAGCTGCTCCGTGGTCTGGCCTACTGCCATCGGCAGAAGGTGCTACACCGTGACCTCAAGCCCCAGAACTTGCTCATCAATGAGAGAGGAGAGCTTAAGCTGGCTGATTTTGGCCTGGCTCGGGCCAAGTCAATTCCAACAAAGACCTACTCCAATGAGGTGGTGACACTATGGTACCGGCCCCCTGACATCCTGCTTGGGTCTACAGACTACTCCACCCAGATTGACATGTGGGGTGTGGGCTGCATCTTCTATGAGATGGCCACGGGCCGGCCCCTCTTCCCAGGCTCCACAGTGGAGGAACAGCTACACTTCATCTTCCGCATCTTGGGAACCCCAACTGAGGAGACATGGCCGGGCATCCTGTCCAACGAAGAATTCAAGACATACAACTACCCCAAGTACCGCTCTGAGACCCTTTTGAGCCATGCACCCCGACTTGACAGCGATGGGGCTGACCTCCTTACCAAGCTGCTGCAGTTTGAAGGTCGCAATCGGATCTCCGCAGAGGACTCCATGAAACACCCATTCTTCCTCGGTCTGGGGGAGCGGATCCACAAACTTCCTGACACTACTTCCATATTTGCACTAAAGGAGATCCAGCTACAAAAGGAGGCCAGCCTTCGCTCTTCGTCAATGCCTGACTCAGGCAGGCCAGCTTTCCGTGTGGTGGACACCGAGTTCTAAGCCACAGACCCAGGCCCCAGCAGGCAGCAGCTGGAGGGATGCCACACCCCTCACAGGGCAGACCCCAACTGCATCCTCCCTGCTTGCTACCTGCCTGACTCATGCTCGCCTGCCCACATGTCCCCTGCTGCCTGTCCAAAAACACATGATCATTGGCCTGTCAACCCACCCATTGGCCTGTCTGCTGGGTGCTAACAAAGCTCTCAATGCTCCTTGCCTGGTCTGTTTGTCTCTCTCTGTCTCAGTAGTTGCCGGCGGACAGCATGGCCGTGCCAGCCTCCCACACTGAGGCCAGGCCTATACCCCTCCCCATCATACCCTCCCCCAGGACCACTACCCCATGGCCAGCCAGGGGTCTGGAGCTAGCCCAGGCTGGGGATCTCGACTCAGACAAGATGGGGATGCCTTGAGTCTGAGGTTTCCCCTGCTTGCTTTCCTGCCTGTCCCACCTGCCTCATGTTGTGTGGGCTTTTTTGTTGTTGTTCATTTCATTCATTGTTTTTTAATTATTTTAAATGAGGTTTTCATTTTTTAAATGCAATATCTCTATACAGACTGGCTGGGCCCCACCCCCTGCGTGTGGCCCTCCCACAGTATTTTGTGCAATGAAGCCCCGCTCCCAGCCTTTCCAAGGCAGGGACACAGCCCCTATTCAGAACCCTGACCATCACCAGACCCTGGGATCGGCTAAGGGAAAGCATGCCTCAACCACTCGCCTTCCTACCCCCCACCTGCCATCCCCAGCCGCAGGGGTACCTGGGGACTACTGGAGACTCTGGGAGATGGACAAGGTTGGGGCCCCAGTCTTTCCCTCTTACAGTCCCATAGCTGGGGCCTCCTTCCTTCTCAGGGTCTCCCTAGCCCAGCCCTCTTGCCCCCACCCCACTCGGTGCTGTTGAGTAGGGGCCCTGCCAGGAACTGACCAACTCAGTGAGGAGCCATAGTATGTCTATGTGCACAGGCAGGGACAGAGGGGCTGGCGGGGGGATGGGGTGTGTGTGCCCAGGAGTTATCCCCTAACCCCTGGGGAGGGTGAGGCAGGGCAGGGACAGTCTCTGGGCTCAGTCCCAGATGGGTGATTACCTCCCCTTCCTCCACTCTAAACCCTGGGTCCCTTAAATGGGGTGGGAGGGCAGGGGTGGGTGCCCTCCTGGTGGGGTTTGGGGGGTTGGTTCC