Transcript asmbl_863

Sequence
Transcript Sequence for observation asmbl_863 of TGE0007816:
GGGAGCGGGATCTCGACTTCCGTATTTACCAATGGCTCCAAAACATACCTCACGTGCAACTTGAGTAGCAGCAACACTGAGATCGTCGGCCACCGCTGGATGAAAGGGGACAAGGTGCTGAAGGAGGATGAGCTGCCCGGCCTGAAAACGGAGTACGAGTTGGACACAGATGAGAGTGGGGGCCAGTACCTCTGTGTCTTCCTCCCGGAGGTCGTGGGCAAGGCCAGCATCAATGTGCCAGGACCCCCCAGAGTGAAGGCCGTGAAAAAGTCAGAGCACGCCACCGAGGGGGAGGGCGTCGTGCTGGCCTGCAAGTCTGAGTCCTTCCCCCCGATCACCGAGTGGGTGTGGTACAAGGTGAGTGACACCGAGCAGCAGGTCCTCACCAACAACTCCCAGAATAAGGTCTACGTGGTGTCCGTGGAGACCAGGACGGAGCTTCACATCCTGAACCTGAACTTGGAGACCGACCCCGGCAAGTACGTCTGCAACGGCAGCAGCGTGGAGGGCACCGACCAGGCCGTCATCGTCCTGCACGTTCGCAGCCAGCTCGCCGCCCTGTGGCCCTTCCTGGGCATTGTGGCCGAGGTGCTTGTGCTGGTCACCATCATCTTCATCTATGAGAAGCGGCGGAAGCCGGACGAGGTCCTGGATGACGAGGACACCGGCTCCGCGCCACTGAAGAGCAGTGGGCACCACGTGAACGACAAGGGCAAGAACGTCCGCCAGAGGAACTCCAGCTGAGCGTGCCACCAGACGAGTCTGCACAGGGCCCGAGCGCTGCTGGAGGAGCCCGGTGTGCCTGCGCTTGCCCGATTCCCAGCTCTGTCCTCTCAAAGGAAACCTGCCCAGCGAGAGCAAACGCTGCGAATCCCAGTCACATTTCCTCTCCTTTTAAGAAAACTAAGCTAAGGTTTTCTCTCTGTAGAGTTCCGTTCCTTAGGGGTTTCGTTCCGTCTTTTTAAGAGTGTTCCAGGGGAGTCTCAAGCTTCTCTGTGGGGCCCTAATGCCCCCTCCCCCTGTGTCCCCTTGCTGTCCCCTGGGCGTCCAGCCTTCTAGTCCATCACGTTGGGGCTGCGGGGGGCAGACTGGCCTTTACCTGACACTCCCACCACGGCTCTGCCTCTGAGGCTGCTCAGTGGTCCCTGTCCTCTGCGGAAGGTCATAGGTCGTGGTGCCCAGCATCCTGCCTGTCTGGAGCCAGTGCTGTCACATCACCTCAGGTCTGTGTGACGTGGGACATCCCTGCCCTCATGGCCACCTATCAGGTGTCCTCTTCACTGCTCGGGCAAGTCCCTGTGCTGGGGGTGGTCTGGTTGACCATCTCAGAGCGGGAGTCCTGTGACAGCCCCTTCCCCGTCAGCCCGTGGCCATGCAGAAACGCCCTCCCCCCCGGGCCCACAGCCTTACTGTCCACAGCACCCTGACTCCGGTACCTGCCCCCTGCCTGCTCACCAATAAAGGCTACCCCACCTCGTC