Transcript asmbl_13202

Sequence
Transcript Sequence for observation asmbl_13202 of TGE0000125:
GGTGGATGCTCTCAGCTGGCTGGCGGGAAGATTTTACTCCCGAGTAGCGGAAAGATCTGCTCGAGGCCTGGGTGCTTTGGTGTCGGAGATCCGAGAGTCGGAGATCGGAGAGTCGGACACAGGACAGTCGGACACCGGACAGTCAAACACCGGAGAGTTAGACCGGGCTTCTCGGTGGGGAGAGGCTCTGGGATAACTACTGTTACAGCTTTGAAGGGTCAAGGGTGTGCGCTTTTTGTTTCATCCTTCCCTTTCCTGCTGCAGGGCGAGGCCGGTCTGTAGCGGATCACTTCCTTTCGCCCACACATTGGCGGAGGAGAAACCGGAAAGTTAATCACTGCCCTGCTCTGAGAACTCGGGCCTTTAGGGGCACGTTCGCCTGCTGACCGGTCTTCTGATCTCCCCATTCTTTTCCATGCAGGAGGATTGGCCACCAAAGCCTGTTTATTAGCAGCTGCCATTTGTTGAAAGAAATTTGGATTATTTTAGAAACAAATTTGGAAAGAAAAAGAATGGCGTCCGTTTCAGCTCTAACTGAGGAACTGGATTCTATAACCAGTGAGCTACATGCAGTAGAAATTCAAATTCAAGAACTTACGGAAAGGCAACAAGAGCTTATTCAGAAAAAAAAAGTCCTGACAAAGAAAATAAAGCAGTGTTTAGAGGATTCTGATGCCGGGGCAAGCAATGAATATGATTCTTCACCTGCCGCTTGGAATAAAGAAGATTTTCCATGGTCTGGTAAAGTTAAAGATATTCTGCAAAATGTCTTTAAACTGGAAAAGTTCAGACCACTTCAGCTTGAAACTATTAACGTAACAATGGCTGGAAAGGAGGTATTTCTTGTTATGCCTACAGGAGGTGGAAAGAGCTTATGTTACCAGTTACCAGCATTATGTTCAGATGGTTTTACACTCGTCATTTGCCCATTGATCTCTCTTATGGAAGACCAATTAATGGTTTTAAAACAATTAGGAATTTCAGCAACCA