Transcript asmbl_8509

Sequence
Transcript Sequence for observation asmbl_8509 of TGE0007832:
CCCAGGAGATGTATCTGCTTGCTGTAGTCTCAGAGACCAACCGGCTCGCCGCGACACCCAGCCTCTAGCCACCTTTGGCACATCTTAATAGATAGTAAACTATCTTTTTGAGGGCGAATCTTAATCTCCTTGGAAACGCTAAAGACGGCGTCTTCCGGGAAGCCTCGCCCCGTGACCTCAGACGTACACTTCCAGGGCACGAACGTGACCCGTCGCCCCGCCCTTTCCCACTCTCTCTTTCCGGTGGCGGAGTCTGGAGAAGGCACGCAGAAATGGCACCTCGCAAGGGGAAGGAAAAGAAGGAAGAACAAGTCATCAGCCTTGGACCTCAGGTGGCTGAAGGAGAAAATGTATTTGGTGTCTGCCACATCTTCGCATCCTTCAATGACACTTTTGTCCATGTCACCGATCTTTCTGGCAAGGAAACCATCTGCCGTGTGACTGGTGGGATGAAGGTAAAGGCTGACCGAGATGAGTCCGCTCCATATGCTGCCATGTTGGCTTCCCAGGATGTGGCCCAGAGGTGCAAGGAGCTGGGCATCACTGCCCTCCACATCAAACTCCGGGCCACAGGAGGAAATAGGACCAAGACCCCCGGACCAGGGGCCCAGTCAGCTCTTAGAGCCCTCGCCCGCTCAGGGATGAAGATTGGACGGATTGAGGATGTCACCCCCATCCCCTCTGACAGCACCCGCAGGAAAGGGGGTCGCCGTGGTCGCCGTCTGTGAACAGGACTCCTCAAATTGTTTTCTGTTAATAAATTGCCTTTGTGTG