Transcript asmbl_8498

Sequence
Transcript Sequence for observation asmbl_8498 of TGE0011314:
CTGCCGACCCTCCGGGGCTAGCGCCCGAGTTCCCTTTCCCAGAGTCCTCTGCGCCGTGAAGAAGCGGCTCCCGGGGACCGGGGGCATTTTGCGTTGGCTGGAGCCGGAGTAACAAGATGGCGGCGTCGGCGGAGTGACAGGGGTCCCTCCGGGAGGGAGCCGGCAGCAGTGGTGGCAGCGGGATCGCCGCCCTAACTCACCGCGCCCCTTTTCCAGCCCGCGACGTCGCCGCGAAAGCGAGGCAGCAGCGGCCGCCCAGACACAAGTGGCCCAGCCTGGTAACCGCGAGGACCCCTCACACACTGCGGCCTGGCGAGAAGAAACCTGCCTGAGCGGCGGTGATCAGGTTCCCCTCGGCTGATTCCGGGCCTGGTAACGCCGAGCCAACGCTTTCAGCTTCCTGCCGCCCTCCTCCGCAGCCTTGCTCCGGGGACGAGCCCAGAGGCCTCCGTCCTCCTCTCAGAGGTGTCGGGGCTCGGCCCCAGCCCCCGTCTGCGCCTCTCAGGATGGCGAGCAGCAGCGGCTCCAAAGCCGAATTCATTGTCGGAGGGAAATATAAACTGGTACGGAAGATCGGGTCTGGCTCCTTCGGGGACATTTACCTGGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTCTATAAAATTCTTCAGGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGTCAGGAAAAAGACTACAATGTGCTAGTCATGGATCTTCTTGGACCCAGCCTTGAAGACCTCTTCAATTTCTGTTCGAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAATCTCACTGGCACTGCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAACAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCATGGCAAGGACTAAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAAGTTTTATGTAAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAACTATTGTCGTGGGCTGCGCTTTGAGGAAGCCCCGGATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCACCAATATGACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCAAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGTATAATTCTTATCCCTACACAACAGATTTCTACTATTTTGACTGCCAGTGTAACTTATATTTCCACATTTTAGTTTGTTAGTGACAGTGGTTTCCATTTTAAAGCTATTTGGATATTCAGTGTAATAGTTATTTCAGTATAATGAAATTGCGTTCACAAGTTTTGGTAAATGAAAACCCAGAAATTTTAGTAGTTGTGAAAACATTTCTCTTTGTCTTATTTAAGAATAATTGCAGTACTTGAAACCAAATGCCCATCAGGATAAGGGTTATTTCTATTCAGCTAATCCATAGTTTTAATTTACTTTAAAATTTCTATGTTTTTAAAGTTGGATTAATTACAGAATGTAGTCAGATTTTTGTTATCTTTCATTTTTGTCATTTGCTTTATGAACGTAGTACTTGGGACAGGCAGCAAAGGTCTCTTCTATACCTTCTCTGGTGTTAGGCACTGTGGAGCAACAGAGTACAGCACTACATCTTGTCCTGGGGTCTTAGCCCAGTATATTTATTGAATGAAGGTGACTTTCAGCCTTCAAATGAAAGAATGTCTAGCTAACAAGTGAGGAAATATTTGCCAACAAATGATATATTAATGTTTGGAATTTGAAAAAAAGGCATATATGCATGAAAACTAATTGTGGAAATATTTTATCCCACAAAGGCCTCTGGAGATAGTCCAACAAATGTTTGAGAAGTACCCAGAAAGGAGCAGTTTGTAATTGATAAAAACATGATTTGTGCTAAAGAAGTGTGAGGTCAGAGTGGGCTAAAATATTGGCTGTAAGAGTTTGGAAGGGGGTGTACCAAGGGGCACTGATGCCTTAAA